ID: 1119296498

View in Genome Browser
Species Human (GRCh38)
Location 14:73537582-73537604
Sequence GTCCAGCTCGCCAAGGGTGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 87}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119296498_1119296508 14 Left 1119296498 14:73537582-73537604 CCGACACCCTTGGCGAGCTGGAC 0: 1
1: 1
2: 0
3: 11
4: 87
Right 1119296508 14:73537619-73537641 CGCGCTGGGCGGCAGCTTCGCGG 0: 3
1: 1
2: 0
3: 13
4: 79
1119296498_1119296511 29 Left 1119296498 14:73537582-73537604 CCGACACCCTTGGCGAGCTGGAC 0: 1
1: 1
2: 0
3: 11
4: 87
Right 1119296511 14:73537634-73537656 CTTCGCGGGGCTTGAGCCCATGG 0: 2
1: 0
2: 2
3: 5
4: 68
1119296498_1119296505 3 Left 1119296498 14:73537582-73537604 CCGACACCCTTGGCGAGCTGGAC 0: 1
1: 1
2: 0
3: 11
4: 87
Right 1119296505 14:73537608-73537630 GAGCGCGCGCCCGCGCTGGGCGG 0: 3
1: 2
2: 2
3: 26
4: 176
1119296498_1119296512 30 Left 1119296498 14:73537582-73537604 CCGACACCCTTGGCGAGCTGGAC 0: 1
1: 1
2: 0
3: 11
4: 87
Right 1119296512 14:73537635-73537657 TTCGCGGGGCTTGAGCCCATGGG 0: 2
1: 0
2: 2
3: 2
4: 29
1119296498_1119296510 16 Left 1119296498 14:73537582-73537604 CCGACACCCTTGGCGAGCTGGAC 0: 1
1: 1
2: 0
3: 11
4: 87
Right 1119296510 14:73537621-73537643 CGCTGGGCGGCAGCTTCGCGGGG 0: 2
1: 1
2: 0
3: 2
4: 77
1119296498_1119296503 -1 Left 1119296498 14:73537582-73537604 CCGACACCCTTGGCGAGCTGGAC 0: 1
1: 1
2: 0
3: 11
4: 87
Right 1119296503 14:73537604-73537626 CCTGGAGCGCGCGCCCGCGCTGG 0: 3
1: 2
2: 4
3: 16
4: 165
1119296498_1119296504 0 Left 1119296498 14:73537582-73537604 CCGACACCCTTGGCGAGCTGGAC 0: 1
1: 1
2: 0
3: 11
4: 87
Right 1119296504 14:73537605-73537627 CTGGAGCGCGCGCCCGCGCTGGG 0: 3
1: 2
2: 0
3: 7
4: 90
1119296498_1119296509 15 Left 1119296498 14:73537582-73537604 CCGACACCCTTGGCGAGCTGGAC 0: 1
1: 1
2: 0
3: 11
4: 87
Right 1119296509 14:73537620-73537642 GCGCTGGGCGGCAGCTTCGCGGG 0: 3
1: 1
2: 0
3: 11
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119296498 Original CRISPR GTCCAGCTCGCCAAGGGTGT CGG (reversed) Exonic
904034463 1:27551369-27551391 GGCCAGCTCACTAAGGATGTCGG + Exonic
904253032 1:29237953-29237975 GTCCTGCGCGCCAAGGGAGGGGG - Intronic
905242359 1:36589127-36589149 AACCAGCTCTCCAAGCGTGTTGG - Intergenic
906617140 1:47241230-47241252 GCCCAATTCCCCAAGGGTGTGGG - Intergenic
907334917 1:53693655-53693677 CTCGGGGTCGCCAAGGGTGTGGG + Intronic
910017776 1:82548301-82548323 GTACAGCACACCATGGGTGTTGG - Intergenic
919650408 1:200143577-200143599 GTCCAGCTTCTGAAGGGTGTTGG - Intronic
919805855 1:201380658-201380680 GTCCAGTTCCCCAAGTGTGTGGG - Intronic
1067850171 10:49749683-49749705 ACCCAGCTCTCCAAGGGTGCCGG + Intronic
1068044647 10:51870954-51870976 GTTCAGCTTGCCTAGGGGGTGGG - Intronic
1075765109 10:124886949-124886971 GTCCAGCTGGCTTAGGGTGAAGG - Intergenic
1075846488 10:125549128-125549150 CTCCAGGTCGCCTAAGGTGTAGG + Intergenic
1077112791 11:869298-869320 GTCCAGCACGGCAAGGGTGCAGG - Exonic
1078829779 11:14968402-14968424 GTCCAGCTAGCCTAGGGTTAAGG + Intronic
1081811323 11:45915694-45915716 GTCCAGCTGGCCAAGTAGGTTGG - Exonic
1081930657 11:46868589-46868611 GTCCAACTCACCAAGGGAGCAGG + Exonic
1084121312 11:67070638-67070660 GTCCAGAACGCTCAGGGTGTAGG + Intronic
1088787202 11:113192962-113192984 GAGCAGATAGCCAAGGGTGTGGG - Intronic
1088925031 11:114293359-114293381 ATCCTGCTCACCAAGTGTGTTGG - Intronic
1097142380 12:56912948-56912970 TTCAAGCTCACCAAGGCTGTGGG - Intergenic
1097474194 12:60033772-60033794 GTGCAGCTGCCCAAGGCTGTGGG - Intergenic
1098213019 12:68186192-68186214 GTCCTGCTCCCCCAGGGTCTTGG - Intergenic
1098741512 12:74178894-74178916 GTGGAGCTCCCCAAGGCTGTGGG - Intergenic
1104746193 12:131211899-131211921 GGCCAGCTGACCAGGGGTGTGGG + Intergenic
1107672565 13:42761186-42761208 GTCCAGCCCGCCCAAGATGTGGG + Intergenic
1111271533 13:85892990-85893012 GTGCAGCTGTCCAAGGCTGTGGG + Intergenic
1116974838 14:51104674-51104696 TTCCAGCTTGCAGAGGGTGTGGG - Intergenic
1119296498 14:73537582-73537604 GTCCAGCTCGCCAAGGGTGTCGG - Exonic
1119300745 14:73569587-73569609 GTCCAGCTCGCCAAGAGTGTCGG - Exonic
1119303960 14:73592120-73592142 GTCCAGCTCGCCGCGGGCGTCGG - Exonic
1119306583 14:73612732-73612754 GTCCAGCTCGTCGCGGGCGTCGG - Intronic
1128638843 15:69320345-69320367 ATCCAGCTCACCAAGGGTCAGGG - Intronic
1131220417 15:90579351-90579373 GTCCACTTCCCCAAGGCTGTCGG - Intronic
1131343534 15:91625367-91625389 CTCCAGCTGGCCAAGCATGTTGG - Intergenic
1131367706 15:91853847-91853869 TTCCCGCTCGCCCCGGGTGTCGG - Exonic
1132236073 15:100222616-100222638 GTCCAGCCCTCCAGGGATGTTGG - Intronic
1132892778 16:2212496-2212518 CACCAGCTCGCCAAGGTTCTGGG - Exonic
1135790238 16:25387630-25387652 GTCCAGCCCATCAAGGCTGTGGG - Intergenic
1138521886 16:57575787-57575809 GCCCAGCTCGCCAGGGATGTGGG + Exonic
1138721608 16:59088780-59088802 GTGCAGCTCGCTAGCGGTGTTGG + Intergenic
1143367847 17:6420134-6420156 CTCCAGCTCCTCAGGGGTGTGGG - Intronic
1143953793 17:10653587-10653609 CTCCAGCTTCCCGAGGGTGTGGG - Intronic
1148076167 17:44936276-44936298 GTCCAGCTCCCGAGGGGTGGGGG + Exonic
1150520787 17:65865524-65865546 GCCCAGCTGTGCAAGGGTGTGGG - Intronic
1151346945 17:73508048-73508070 GTCCTGCTCCCCAAGGCTGGGGG + Intronic
1151818082 17:76481390-76481412 GTCCTGCTCGCCAGGGGCCTGGG + Exonic
1153092026 18:1357934-1357956 GGCCAGCTTGCCAAGGGTGCAGG + Intergenic
1156100377 18:33586666-33586688 GGCAAGCTGGCCAAGGGTGTGGG - Intronic
1157077315 18:44479805-44479827 GCACAGCTCCCCAAGGCTGTGGG + Intergenic
1157431106 18:47627289-47627311 GTCCAGCAGGCAAAGGGTGCTGG + Intergenic
1160704758 19:524727-524749 GTCCAGGTGGGCGAGGGTGTTGG - Intergenic
1160704779 19:524782-524804 GTCCAGGTGGGCGAGGGTGTTGG - Intergenic
1160704821 19:524894-524916 GTCCAGGTGGGCGAGGGTGTTGG - Intergenic
1161457059 19:4374815-4374837 GCCCAGCTCCACATGGGTGTGGG + Intronic
1163118129 19:15200350-15200372 GCCCAGCCCGCCCGGGGTGTCGG + Intronic
1165318004 19:35068380-35068402 CTCAACCTCGCCAGGGGTGTGGG - Intergenic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1165533259 19:36421687-36421709 GTCCAGCTCGCCGCGGGCGTCGG - Intergenic
1165945274 19:39437958-39437980 GTCCAGCTCTAAAAGGGTGAGGG + Intronic
1166726938 19:45034283-45034305 GTTCAGCTCCCCAAGGACGTCGG - Exonic
927939426 2:27094427-27094449 GTGCAGTTCGACAAGGGTTTTGG - Intronic
928376608 2:30779479-30779501 GTCCAGCTTTACAAGGCTGTTGG - Intronic
932212792 2:69946023-69946045 GTCTGGCTGGCCAATGGTGTTGG - Intergenic
933184155 2:79260128-79260150 GGCCAGCTTGCCATGGGTGTTGG + Intronic
939258219 2:139772728-139772750 GTCCAGCTCTCTAAGGGTGGAGG - Intergenic
941448965 2:165635755-165635777 GTACAGCTCACCAGGGTTGTAGG + Intronic
946282371 2:218675430-218675452 ATCCTCCTCGCCAAGGGTGGTGG + Exonic
947591175 2:231386893-231386915 ATCCAGTTCCTCAAGGGTGTGGG + Intergenic
1171122446 20:22578552-22578574 GTCCAGCTCGCGGAGGGAGGAGG + Intergenic
1172481054 20:35271617-35271639 GCCCAGCTCCCCCAGGCTGTGGG - Exonic
1175685849 20:61028292-61028314 GTGCAGCTTTCCAAGGGTGCGGG + Intergenic
1181027599 22:20134762-20134784 AGCCAGATCGCCAAGGGTCTTGG + Intronic
1182369675 22:29802008-29802030 GTCCAGCTGGCTGAGGGTGGGGG + Exonic
1183062401 22:35344334-35344356 GTGCTGCTCTCCAAGGGAGTGGG + Intronic
1184479416 22:44738027-44738049 GTCCAGGTGGCCTAGGGGGTGGG + Intronic
1185030138 22:48438366-48438388 GTCCATGACGGCAAGGGTGTCGG + Intergenic
956620935 3:71221055-71221077 CCCCAGCTCCCCAAGGGTCTGGG + Intronic
961741226 3:129034229-129034251 CTCCAGCTCCCCCAGGGTATGGG - Exonic
970061576 4:12039736-12039758 CTGCAGCTGTCCAAGGGTGTGGG + Intergenic
972960653 4:44448436-44448458 GTCCAGCTCGCCCGGCGCGTCGG - Exonic
978195454 4:105966811-105966833 AGCCAGATCGCCAGGGGTGTTGG + Intronic
983495095 4:168434683-168434705 GACCAGCTAGCCAATGCTGTAGG - Intronic
1001979689 5:176030491-176030513 GACCAACCTGCCAAGGGTGTGGG + Intronic
1002237728 5:177813272-177813294 GACCAACCTGCCAAGGGTGTGGG - Intergenic
1023467280 7:40469938-40469960 ATCCAGCTCCCCAAGTGTTTAGG - Intronic
1023612081 7:41981541-41981563 GTCCAGCTCCTCCAGTGTGTTGG - Intronic
1025861869 7:65337926-65337948 GTGAAGCTCGCCAAGGCTGTGGG + Intergenic
1027229484 7:76263941-76263963 GGCCAGCTCACCAGGGGTTTAGG - Intronic
1029390297 7:100270335-100270357 GTCCAGCCCGGCTAGGGAGTGGG + Intronic
1031803234 7:126275485-126275507 GTGGAGCTCTCCAAGGCTGTGGG - Intergenic
1032740911 7:134738077-134738099 GTTCAGGCCTCCAAGGGTGTTGG + Intergenic
1040565853 8:48566183-48566205 GGCCAGCTCTGCAAAGGTGTTGG + Intergenic
1045417845 8:101984918-101984940 TTCCAGCTCCCAAAGTGTGTGGG - Intronic
1058223072 9:102326243-102326265 GTGCAGCTGCCCAAGGCTGTGGG + Intergenic
1186862772 X:13689484-13689506 GTCCCTCTCCCCAAGGGTGTGGG - Intronic
1187155229 X:16715263-16715285 ATCCAGGTCTCCATGGGTGTTGG + Intergenic
1192237009 X:69302372-69302394 GTCCTGCTCGCCAAGGCTCAAGG + Intergenic
1192873244 X:75204876-75204898 GTCCAGCTCTCAGAGGTTGTGGG + Intergenic
1200248053 X:154536241-154536263 GCCCAGATCACCAAGGGTGGAGG - Intronic
1200249092 X:154542644-154542666 GTCCTGCTTGCCCAGGCTGTGGG + Intronic