ID: 1119303685

View in Genome Browser
Species Human (GRCh38)
Location 14:73590698-73590720
Sequence GCCGGCCGGCCCGCAAGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119303685_1119303695 17 Left 1119303685 14:73590698-73590720 CCGGGGCTTGCGGGCCGGCCGGC No data
Right 1119303695 14:73590738-73590760 CGCCGAGCCCACGCCCACCCGGG No data
1119303685_1119303694 16 Left 1119303685 14:73590698-73590720 CCGGGGCTTGCGGGCCGGCCGGC No data
Right 1119303694 14:73590737-73590759 CCGCCGAGCCCACGCCCACCCGG 0: 79
1: 581
2: 637
3: 391
4: 425
1119303685_1119303699 28 Left 1119303685 14:73590698-73590720 CCGGGGCTTGCGGGCCGGCCGGC No data
Right 1119303699 14:73590749-73590771 CGCCCACCCGGGACTCGCGCTGG No data
1119303685_1119303689 -7 Left 1119303685 14:73590698-73590720 CCGGGGCTTGCGGGCCGGCCGGC No data
Right 1119303689 14:73590714-73590736 GGCCGGCCGCTCCAAGTGCGGGG 0: 13
1: 75
2: 361
3: 600
4: 545
1119303685_1119303687 -9 Left 1119303685 14:73590698-73590720 CCGGGGCTTGCGGGCCGGCCGGC No data
Right 1119303687 14:73590712-73590734 CCGGCCGGCCGCTCCAAGTGCGG No data
1119303685_1119303688 -8 Left 1119303685 14:73590698-73590720 CCGGGGCTTGCGGGCCGGCCGGC No data
Right 1119303688 14:73590713-73590735 CGGCCGGCCGCTCCAAGTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119303685 Original CRISPR GCCGGCCGGCCCGCAAGCCC CGG (reversed) Intergenic
No off target data available for this crispr