ID: 1119305512

View in Genome Browser
Species Human (GRCh38)
Location 14:73604990-73605012
Sequence TGGGACTCATTGGGAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119305512_1119305519 24 Left 1119305512 14:73604990-73605012 CCTGTTTTTCCCAATGAGTCCCA No data
Right 1119305519 14:73605037-73605059 TTCTCATGTGTGCATAAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119305512 Original CRISPR TGGGACTCATTGGGAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr