ID: 1119310567

View in Genome Browser
Species Human (GRCh38)
Location 14:73642988-73643010
Sequence CCTGTTCACCAGAGAATGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119310567_1119310570 6 Left 1119310567 14:73642988-73643010 CCACACATTCTCTGGTGAACAGG No data
Right 1119310570 14:73643017-73643039 AATCTATTTTGTCATTTTGTAGG No data
1119310567_1119310571 27 Left 1119310567 14:73642988-73643010 CCACACATTCTCTGGTGAACAGG No data
Right 1119310571 14:73643038-73643060 GGATATGAAAGAACAAAAGAAGG No data
1119310567_1119310572 28 Left 1119310567 14:73642988-73643010 CCACACATTCTCTGGTGAACAGG No data
Right 1119310572 14:73643039-73643061 GATATGAAAGAACAAAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119310567 Original CRISPR CCTGTTCACCAGAGAATGTG TGG (reversed) Intergenic
No off target data available for this crispr