ID: 1119315323

View in Genome Browser
Species Human (GRCh38)
Location 14:73689494-73689516
Sequence CCCAAACTGAAAAAGCTGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 227}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119315323 Original CRISPR CCCAAACTGAAAAAGCTGGA TGG Exonic
901473259 1:9472286-9472308 CTCAACCTGTAAAGGCTGGATGG + Intergenic
902112392 1:14093222-14093244 CCCAAACTGCAAAGGATGGAGGG - Intergenic
903679454 1:25087526-25087548 CCCAGACTGGGAAAGCTGGAAGG + Intergenic
904018745 1:27444678-27444700 CAAATACTGAAAAAGATGGATGG + Intronic
904273126 1:29363332-29363354 CCCAAATGGACAAACCTGGAGGG + Intergenic
905337803 1:37257472-37257494 ACAAAACTGGAAAAGCTGGATGG + Intergenic
910737555 1:90477373-90477395 GCCAAAGAGAAAAAGTTGGAAGG + Intergenic
911181365 1:94863353-94863375 CCCAAACTCTAATACCTGGAGGG + Intronic
914434854 1:147650675-147650697 CCCAAACTCCAAAAGAAGGAAGG - Intronic
914691400 1:150031701-150031723 CCCAAGGTCAAAGAGCTGGAAGG - Intergenic
915245342 1:154552300-154552322 CCCTGAATGAAAATGCTGGATGG + Intronic
915541320 1:156568511-156568533 AACAAACAGAAAAACCTGGATGG - Intronic
915779443 1:158530217-158530239 CACAAACTGGAAAATCTAGAGGG + Intergenic
916496808 1:165354767-165354789 CCCAAACTTGAAAAGCTCCAAGG + Intronic
916624147 1:166535377-166535399 CCCAAAATTACAAAGCTGAAGGG - Intergenic
918611569 1:186498231-186498253 CCCAGGCTGAAAAAGCAGGTAGG - Intergenic
918827124 1:189338550-189338572 CTGAAAGAGAAAAAGCTGGAAGG + Intergenic
918863652 1:189865470-189865492 CCCAAACTATAAAAGTAGGACGG - Intergenic
921342648 1:214149807-214149829 CCCATACTGAAAGAGTGGGAAGG - Intergenic
922012397 1:221603273-221603295 ACCACACTGAAACATCTGGATGG + Intergenic
922114891 1:222603293-222603315 CCCAAATTTAAAAAGCTGGCTGG - Intergenic
924737767 1:246774065-246774087 ACCAAAATGAAAAAGCCAGAAGG - Intergenic
1063075792 10:2714951-2714973 CCCAAATTAAAAAAGAAGGAAGG - Intergenic
1063255801 10:4326098-4326120 CCCAAAATGAACAAGCGGAACGG - Intergenic
1064525012 10:16246135-16246157 GCCAAACTGATAAAACTGAACGG + Intergenic
1066362440 10:34744403-34744425 TCCAAGATGAAAAAGCTGAAAGG + Intronic
1068334201 10:55610151-55610173 TGCAAACTCTAAAAGCTGGAAGG + Intronic
1069320307 10:67162030-67162052 CAAAAACTGACAAAGCTGAACGG + Intronic
1071273971 10:84035879-84035901 CCCAAACCTAAAAGGCAGGAGGG + Intergenic
1072944000 10:99793356-99793378 CACTAAAAGAAAAAGCTGGATGG + Intronic
1074045626 10:109836019-109836041 ACCAAACTGTAAAAGCTTCATGG + Intergenic
1074521075 10:114224617-114224639 CCTAAATTTAAAAAGTTGGAAGG - Intronic
1075905845 10:126081347-126081369 TTTAAACTGAAAAATCTGGATGG - Intronic
1077243228 11:1522489-1522511 CAAAAACTGAAAAGGCTGGCCGG - Intergenic
1079019125 11:16894637-16894659 CCCAAAATGAAGAAGGTGAATGG + Intronic
1080318236 11:30974592-30974614 CGCAAACTGGAAAACCTAGAGGG + Intronic
1080904731 11:36530945-36530967 CAAAAACTGAAAAAACTGAAAGG - Intronic
1081714475 11:45238818-45238840 CACAAAATGTTAAAGCTGGAAGG + Intergenic
1081714479 11:45238874-45238896 CACAAAATGTTAAAGCTGGAAGG + Intergenic
1082631236 11:55544623-55544645 CCCAAACAGGAAAAACAGGAAGG - Intergenic
1084996580 11:72985741-72985763 CCCAAACTGAAAAAGGATCAAGG - Intronic
1085689635 11:78654779-78654801 CCCAAACAGACATTGCTGGAGGG - Exonic
1089322101 11:117633345-117633367 TCCCAACTGCAAGAGCTGGAGGG + Intronic
1089597005 11:119586655-119586677 CCTAGAATGAGAAAGCTGGAGGG + Intergenic
1090168088 11:124572508-124572530 CACAAATTTTAAAAGCTGGATGG + Intergenic
1090526013 11:127537580-127537602 CCAATATTGAAAAATCTGGATGG + Intergenic
1093575877 12:20729476-20729498 CATAAACTGAAAAAGCTAGCAGG + Intronic
1094016333 12:25868368-25868390 CCAAAACTATAAAGGCTGGAAGG + Intergenic
1094149711 12:27269558-27269580 GCCAAAAGAAAAAAGCTGGAGGG - Intronic
1097158581 12:57029804-57029826 CCCAAGCTGCAGAAGCTGAAAGG - Exonic
1100259165 12:92915490-92915512 CAAAAACAAAAAAAGCTGGAAGG + Intronic
1108523087 13:51262188-51262210 GCCAACCTGACAAAGCTGGCAGG - Intronic
1108784674 13:53881767-53881789 GACACACTGAAAAAGCAGGAAGG + Intergenic
1109733681 13:66452413-66452435 CCCAAACTCAAAATTTTGGATGG + Intronic
1109918477 13:69023496-69023518 CTAAAACTGAACATGCTGGAGGG + Intergenic
1111212304 13:85095208-85095230 CCCAGCCTGAAAAGGCAGGATGG - Intergenic
1111763761 13:92499895-92499917 CCCAAACTGAAAATCCTAGATGG - Intronic
1111783840 13:92763350-92763372 CCAAAGCTGAAGAAGCTGAATGG - Intronic
1111978042 13:94987950-94987972 CCCAGACTTTAAAAGCTGGAAGG + Intergenic
1113834603 13:113320445-113320467 CCCGAACTGGAAGAGCAGGACGG - Exonic
1116545643 14:46162574-46162596 GCCAAAATCACAAAGCTGGAGGG - Intergenic
1116954583 14:50911069-50911091 CCCAAACTGAAAAGGTAGAAAGG - Intronic
1119104623 14:71912505-71912527 CCAAAACTGAAGAAGGAGGAAGG + Intergenic
1119315323 14:73689494-73689516 CCCAAACTGAAAAAGCTGGATGG + Exonic
1120410861 14:84153794-84153816 ACAAGACTGAGAAAGCTGGAAGG - Intergenic
1120684126 14:87518093-87518115 AAAAAACTAAAAAAGCTGGAAGG - Intergenic
1120695519 14:87640093-87640115 CACAATCTCAAATAGCTGGAGGG + Intergenic
1122091013 14:99340572-99340594 CCTAAACTACAAAACCTGGATGG + Intergenic
1124700710 15:31909622-31909644 CCCAAAGTCAAATAGCTGGCAGG - Intergenic
1125481905 15:40087030-40087052 CCCAAATGGAAACAGATGGATGG + Intergenic
1127161152 15:56187718-56187740 CACAAAAAGAAACAGCTGGAAGG + Intronic
1127652245 15:61020772-61020794 CCCAAACTGACAAAACTTCAAGG + Intronic
1128307711 15:66610968-66610990 CTTAAACTGAAAAACCTGGCCGG - Intronic
1128562744 15:68679278-68679300 CCCAGACTGGCAGAGCTGGAAGG + Intronic
1130403243 15:83576583-83576605 CATCACCTGAAAAAGCTGGAAGG + Exonic
1130582006 15:85146057-85146079 CCCAAACTGATAGAACTGTAAGG + Intergenic
1131150977 15:90047015-90047037 CCCAAACTGGAAAAACCTGATGG - Intronic
1137447004 16:48538093-48538115 CCCAGTCAGAAAATGCTGGAAGG - Intergenic
1138353506 16:56359757-56359779 CCAAAAGAGAAAAAGCAGGAAGG - Intergenic
1138438356 16:57019595-57019617 CCCATACTGAGGAAGGTGGAAGG - Intronic
1138873031 16:60915957-60915979 GCATAACTGGAAAAGCTGGAGGG + Intergenic
1141281331 16:82632228-82632250 CCCAAACTCAAAAAGCCCTAGGG - Intronic
1146074028 17:29711530-29711552 CCCCATCTGTAAAAGCTAGAAGG - Intronic
1146859926 17:36288011-36288033 ACAAAACTAAAAAAGCTGGAAGG - Intronic
1147090252 17:38092104-38092126 ACAAAACTAAAAAAGCTGGAAGG - Intergenic
1147106961 17:38228422-38228444 ACAAAACTAAAAAAGCTGGAAGG + Intergenic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1148252974 17:46102035-46102057 ACCAAATTTAAAAAGATGGAGGG + Intronic
1148422562 17:47560124-47560146 ACAAAACTAAAAAAGCTGGAAGG - Intronic
1148485210 17:47986529-47986551 CCCAGGCTGAAAAGGCTGGTGGG - Intergenic
1150113087 17:62519446-62519468 CCAATCCTGAAAAAGCAGGAAGG - Intronic
1151279214 17:73059812-73059834 CCCAAAATGAGAAAGAGGGAAGG + Intronic
1153520144 18:5944021-5944043 CCCAGACTTAAAGTGCTGGAGGG + Intergenic
1153769387 18:8403012-8403034 TCTAAATTGAGAAAGCTGGAAGG + Intronic
1153862721 18:9230243-9230265 AACAAACTGAAAAACCTAGAGGG - Intronic
1155933565 18:31731224-31731246 CCAAGACTGACAGAGCTGGAGGG - Intergenic
1155949436 18:31893898-31893920 ACTAAACTGCAAAACCTGGATGG + Intronic
1157185332 18:45535695-45535717 CACAAAATGAAAAAGCTTCATGG + Intronic
1157557636 18:48623044-48623066 CCCAGACTGAAAGCGCTGGGAGG - Intronic
1157582246 18:48780476-48780498 TCAAAACTGCAAAGGCTGGAGGG + Intronic
1157777621 18:50408205-50408227 CCTTAGCTGAGAAAGCTGGACGG + Intergenic
1158422937 18:57312410-57312432 CCCAGACTGAAAAAACTGTGTGG + Intergenic
1160382316 18:78469577-78469599 TCCAAACAGAAAAAACTTGAAGG + Intergenic
1161417169 19:4153828-4153850 CCCAAGCTGCCAGAGCTGGAAGG + Intronic
1163010952 19:14425765-14425787 CCCAGACTGCAAAGGCTGGAGGG - Intergenic
1164788984 19:30959939-30959961 CTCAAATTGAAAAAGGTGAAAGG - Intergenic
1166778577 19:45327580-45327602 CCCAAAGTCACACAGCTGGAAGG + Intergenic
1167674751 19:50877362-50877384 CCCAACATGGAAATGCTGGAGGG + Intronic
928391640 2:30915188-30915210 CCAAAACTGGAAGTGCTGGATGG + Intronic
929501825 2:42496900-42496922 CCCAAATTCAAAAACCTGAAAGG + Intronic
935628127 2:105187962-105187984 TCCAAATAGAAAAGGCTGGAGGG - Intergenic
936350974 2:111712317-111712339 CCCAAACTGAACATGATTGAAGG + Intergenic
937820178 2:126301761-126301783 CCTAATCTGAAAAAGCTATAAGG + Intergenic
937842721 2:126540070-126540092 AACAAACTGAAAAAGTTGAATGG + Intergenic
938100559 2:128495199-128495221 CACAGACACAAAAAGCTGGAGGG - Intergenic
938175972 2:129129101-129129123 TCCAAACTGAAACAGCTTGGGGG - Intergenic
939370515 2:141293297-141293319 CCCAAAGTGAGAAAACTGTAAGG - Intronic
940411462 2:153368675-153368697 CACAAATTGAAAAAGCTGAGAGG + Intergenic
941337338 2:164262103-164262125 CAGCAACAGAAAAAGCTGGATGG + Intergenic
942294088 2:174500758-174500780 CCTAAACTCAAAAGGCAGGAGGG + Intergenic
942745454 2:179226870-179226892 ACCTAACTGAGAAAGCTGGCAGG - Intronic
943672582 2:190679502-190679524 AGAATACTGAAAAAGCTGGATGG - Intronic
944493732 2:200284792-200284814 TACAAACTGATTAAGCTGGAGGG + Intergenic
944533937 2:200691569-200691591 CCCAGACTGAAATAAATGGAGGG + Intergenic
946065692 2:216985582-216985604 CCCCAACAGAAAAAACTGGGTGG + Intergenic
947596970 2:231419094-231419116 CCCGCACTGAAACAGCTGGCTGG + Intergenic
1169898326 20:10527889-10527911 TCCCAAATGAAAAAGCAGGATGG - Intronic
1172034694 20:32002545-32002567 CCCATCATGAAATAGCTGGAAGG + Exonic
1173998708 20:47358848-47358870 CCCAACCTGACAAAGCTCCAGGG + Intergenic
1175370376 20:58484330-58484352 CCCAGACTCTAGAAGCTGGAGGG - Intronic
1177571538 21:22893416-22893438 AGCAAACTGAAAAAGGTTGATGG - Intergenic
1177983470 21:27944419-27944441 CCAAAACTGAATAAACTGAAAGG - Intergenic
1178900793 21:36596963-36596985 CACCAACTCAAAGAGCTGGAGGG + Intergenic
1183736610 22:39648146-39648168 CCCAGACTGTGAGAGCTGGAAGG - Intronic
950677607 3:14564120-14564142 CCCATACTGAAAACGCTTGGTGG - Intergenic
951589442 3:24247434-24247456 CCCCAACTGTAAAATGTGGATGG - Intronic
952992975 3:38848137-38848159 TCCAAACTCAAAAAGCTGAAGGG + Intronic
953388775 3:42522672-42522694 CCCACCCTGAGACAGCTGGAAGG - Intronic
953744153 3:45560427-45560449 CCAAAAGTGAAGAAGCCGGACGG + Intronic
953794503 3:45974080-45974102 CCCAAAATGAAAAAGATGCCTGG + Intronic
956014724 3:64869749-64869771 CTCAAGCTAAAAAAGGTGGATGG + Intergenic
959294604 3:104519981-104520003 CCAAAACAGAAAAAGCAGGGAGG + Intergenic
959641846 3:108647202-108647224 ACCAAACAGAGAAAGCAGGAAGG - Intronic
961756474 3:129130096-129130118 CCCAAAGTGAAGAAGCCAGAAGG - Exonic
963376153 3:144467559-144467581 CCAAAGATGAAAAAGCTGGTGGG - Intergenic
964062694 3:152543051-152543073 CACAAACTAAAAAACATGGAAGG + Intergenic
966189669 3:177260718-177260740 CCCAAAGTGAACAAGCTGCCTGG - Intergenic
966569546 3:181426313-181426335 TCCAAAGTGATAAAGCAGGAAGG + Intergenic
967223891 3:187273236-187273258 CCCAGGCTGATAGAGCTGGAAGG + Intronic
967292810 3:187937721-187937743 CACAAAATGACAAAACTGGAAGG + Intergenic
967570667 3:191024860-191024882 GCCAAAGTGAAAAAGTTTGAGGG + Intergenic
967650623 3:191981492-191981514 ACCAAAAAAAAAAAGCTGGATGG + Intergenic
969379365 4:6783565-6783587 CCCAAAAGGACAATGCTGGAGGG - Intronic
971926488 4:33015747-33015769 CCCAGAGTTAAAAATCTGGAAGG - Intergenic
972343217 4:38170879-38170901 CTGACACTGAAAAAGTTGGAGGG + Intergenic
973780948 4:54287839-54287861 CCCAAAATGAAAAAGCAGCTGGG - Intronic
974352292 4:60764678-60764700 CCTAAGATGAAAAAGATGGAAGG - Intergenic
979615592 4:122739159-122739181 CCCAAAATCAAAATGCTGGCAGG - Intronic
980390485 4:132139449-132139471 CCCACAGTGAAAAACATGGATGG - Intergenic
985533002 5:444635-444657 CTCAAAGGGAAAAAACTGGAAGG + Intronic
987113553 5:14709188-14709210 TCCAAACTGAGAAAGCAGGCCGG - Exonic
987717072 5:21585865-21585887 CAGAAACTGAGAAAGCTAGATGG + Intergenic
989568167 5:42922052-42922074 CCCAAACTGAAAAGGAGGTAAGG - Intergenic
989568176 5:42922135-42922157 CCCAAAATGATAAATCAGGAAGG + Intergenic
989785877 5:45328909-45328931 CCCAAACTGAAAAACTCAGAAGG - Intronic
991658419 5:68926453-68926475 ACTAAACTGCAGAAGCTGGAGGG - Intergenic
992220954 5:74572953-74572975 AACAAACTGCAAAAGCAGGAAGG + Intergenic
992407691 5:76475451-76475473 TCCAAACTGAAGAAGCTTCAAGG + Intronic
993756009 5:91730951-91730973 CCCAAAATGAAAAATATTGATGG - Intergenic
993930070 5:93927007-93927029 CCCAAAATGAAAAAACTGCTTGG + Intronic
996184709 5:120461879-120461901 CCCAAACTGAGAAAGCTGGTAGG - Intergenic
996201492 5:120680479-120680501 CCAAAAGTGAAAAACCTGCAAGG + Intronic
998766480 5:145493352-145493374 AGCAAAGTGAAAAAACTGGATGG - Intronic
1000531230 5:162422818-162422840 CCCAAAGTCAAAAAGCAGGGTGG + Intergenic
1002682016 5:180973045-180973067 CCCAAACAGATAAAGATGGCAGG + Intergenic
1005368970 6:25110077-25110099 CCCACACTGAAAAAGCTTGCTGG - Intergenic
1009568491 6:65347334-65347356 GAAAAACTGAAAAAGCTGAAAGG - Intronic
1010124649 6:72418112-72418134 CCTAAAATGTTAAAGCTGGAAGG + Intergenic
1010287884 6:74100255-74100277 TCCAACCTGAAAAGGCTGGAAGG + Intergenic
1012722199 6:102758906-102758928 CCAAGAGTCAAAAAGCTGGAGGG - Intergenic
1012746729 6:103100525-103100547 CCAAAACTAAAAAGCCTGGAAGG + Intergenic
1014549980 6:122779162-122779184 GCCAAACTGAAAAAGAGGGCGGG - Intergenic
1014694727 6:124605503-124605525 TCCAAACTGAAAAAGTCAGAGGG + Intronic
1016013372 6:139161006-139161028 TCCAAACTGGAAAAGCAGCAGGG - Intronic
1016270355 6:142281454-142281476 CCAAAACTGACAAAACTGAAAGG - Intergenic
1016314693 6:142772529-142772551 CCCAAACTGCAGATGCAGGAAGG - Exonic
1016421533 6:143889666-143889688 CAAAAACTGACAAAACTGGAAGG + Intronic
1017813941 6:158003418-158003440 CCAAAACTGATAACTCTGGAAGG + Intronic
1018444183 6:163840251-163840273 CCCATAGTGAAAAAGCAGAAGGG + Intergenic
1018630350 6:165816825-165816847 CCCCAACAGAAAAAGCTCTACGG - Intronic
1019721250 7:2572942-2572964 CCCAACCAGTAAAAGCAGGAAGG - Intronic
1021241988 7:18213907-18213929 ACTAAACTTACAAAGCTGGAAGG - Intronic
1024002785 7:45202064-45202086 CCCAAATTGTCAGAGCTGGAAGG + Intergenic
1024056789 7:45664614-45664636 CACAAACTTAAGAAACTGGAAGG - Intronic
1024220156 7:47280930-47280952 AACAAACTGGAAAAGCTGGTAGG + Intronic
1024369504 7:48564068-48564090 CCCAAAAGAAAAAAGCTAGAGGG - Intronic
1024826316 7:53394861-53394883 CAAAAACTGAAAAAACTGAAAGG - Intergenic
1026146156 7:67748565-67748587 CCCAAAGTTACAAAGCTGGGAGG + Intergenic
1027519520 7:79188058-79188080 CCCAAACTGAATTACATGGAAGG - Intronic
1033299097 7:140170526-140170548 CCCAAGATGGAAAGGCTGGAAGG - Intronic
1034442787 7:151095441-151095463 ACCAAACTGAAAAGGCTAAAGGG - Intronic
1036941248 8:13054663-13054685 CCCAAAGTGGAATTGCTGGATGG - Intergenic
1037056892 8:14453689-14453711 CCCAAACTGAAAAATCTGTAGGG - Intronic
1037989236 8:23308783-23308805 CACAGACTGACAGAGCTGGAAGG + Intronic
1040737838 8:50532334-50532356 CCCAAAGTAAAATAGCTAGAGGG - Intronic
1041421678 8:57673638-57673660 CCCATACTGAGGAGGCTGGATGG - Intergenic
1043097482 8:75994109-75994131 TCCAAACTGAAACAGTTGAAGGG + Intergenic
1045167680 8:99625113-99625135 CACAAACAGAAAAGGCTGGGAGG + Intronic
1046178432 8:110610304-110610326 ACCACACTGCAAAAGCAGGATGG + Intergenic
1046521811 8:115334587-115334609 CCCAAACAGAAACACCAGGATGG + Intergenic
1046647984 8:116806337-116806359 CCCAAACCCACAAAGTTGGAGGG - Intronic
1046706594 8:117460351-117460373 CCCAAAGTGAAGTAGCTGGTGGG - Intergenic
1050203085 9:3169364-3169386 CCAAACCTGAAAAATCTGAAAGG + Intergenic
1051191928 9:14522060-14522082 CCCAAACTGACAAATATGGCTGG + Intergenic
1052645947 9:31233156-31233178 CCCTGACTGAAAGATCTGGAAGG + Intergenic
1052694979 9:31866214-31866236 AACAAACTGAAAAACCTAGAAGG - Intergenic
1053540386 9:38967779-38967801 CCCAAACTCACTAAGCTGAAGGG + Intergenic
1053804734 9:41789937-41789959 CCCAAACTCACTAAGCTGAAGGG + Intergenic
1054140549 9:61525526-61525548 CCCAAACTCACTAAGCTGAAGGG - Intergenic
1054625755 9:67396144-67396166 CCCAAACTCACTAAGCTGAAGGG - Intergenic
1054904220 9:70400691-70400713 CCCAGAGGGAAAAACCTGGATGG - Intronic
1057278424 9:93691104-93691126 CAAAAACTGATAAAGCTGAAAGG + Intergenic
1057497103 9:95570125-95570147 TCCAAAATGAAGATGCTGGAGGG + Intergenic
1058370304 9:104258763-104258785 CCTTTACTGAGAAAGCTGGACGG + Intergenic
1060880047 9:127111781-127111803 CCCAAAATCAGAAAGCTAGAAGG + Intronic
1061641703 9:131963125-131963147 CCCAAACAGAAAATGATGTATGG - Intronic
1186353184 X:8761009-8761031 GCCAATCTGAAAAGGCTGCATGG - Intergenic
1187272072 X:17788481-17788503 CCCAGACTGAAAATCCTGAAGGG - Intergenic
1187319277 X:18225998-18226020 CCCAGACTGAAAACCCTGGAGGG + Intergenic
1189131518 X:38502874-38502896 CCTGAACTGAAACAGCAGGAGGG - Intronic
1189564059 X:42221328-42221350 CCCAAACTCACACAGCTGGAAGG + Intergenic
1189731987 X:44030632-44030654 CTCAAACAGAAGAAGTTGGATGG + Intergenic
1189907066 X:45772089-45772111 CCCCACATGAAAAATCTGGAAGG + Intergenic
1190277127 X:48906027-48906049 CCCAAAATCACACAGCTGGAAGG + Intronic
1190395331 X:49976297-49976319 CCTAAAGTGAAAAATCTGGTTGG + Intronic
1191643735 X:63455901-63455923 CACAAACTGGAAAACCTAGAAGG + Intergenic
1192710431 X:73577685-73577707 GCAAAAGTGAAAAAGCTGAACGG - Intronic
1194091466 X:89584749-89584771 CGGAAACTACAAAAGCTGGAAGG - Intergenic
1196590334 X:117480185-117480207 CAGAAACTGTAAAAGCTAGAAGG - Intergenic
1198125560 X:133640332-133640354 TCCACACTGAGACAGCTGGAGGG - Intronic
1199347174 X:146755250-146755272 CACAAAATGCCAAAGCTGGAAGG + Intergenic
1199858920 X:151782038-151782060 GCCAAACTGAAGAAGCTACAGGG + Intergenic
1199997051 X:153032060-153032082 ACCAAGCTGAACATGCTGGATGG + Intergenic
1200444106 Y:3240811-3240833 CGGAAACTACAAAAGCTGGAAGG - Intergenic
1200809225 Y:7464819-7464841 CACAAACTGAAAAAGGATGAGGG - Intergenic
1201283739 Y:12361936-12361958 TCTTAGCTGAAAAAGCTGGATGG - Intergenic