ID: 1119316864

View in Genome Browser
Species Human (GRCh38)
Location 14:73703820-73703842
Sequence CAGAGCAAAGAGCAGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1145
Summary {0: 10, 1: 34, 2: 50, 3: 113, 4: 938}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119316864_1119316867 4 Left 1119316864 14:73703820-73703842 CCGTCCTCCTGCTCTTTGCTCTG 0: 10
1: 34
2: 50
3: 113
4: 938
Right 1119316867 14:73703847-73703869 AAAGATCCACCTACGACCTCAGG 0: 290
1: 334
2: 165
3: 83
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119316864 Original CRISPR CAGAGCAAAGAGCAGGAGGA CGG (reversed) Intergenic
900377036 1:2359577-2359599 AGGAGCAAAGAGGAAGAGGAAGG + Intronic
900474557 1:2869996-2870018 CAGAGGGAAGAGGAGGATGAAGG + Intergenic
900970514 1:5990101-5990123 AGGAGCAAGGAGCAGGTGGAAGG - Intronic
901513574 1:9730581-9730603 GAGAGCAGCGAGGAGGAGGAGGG - Exonic
901653441 1:10755905-10755927 CAGATCAAAGCCCTGGAGGATGG + Intronic
901673648 1:10870116-10870138 CTCAGCACAGAGCAGGAGAATGG - Intergenic
901747765 1:11385836-11385858 CAGAGCCAAAAGCTGGAGGAAGG - Intergenic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
903360664 1:22775044-22775066 AATAGCAAGGGGCAGGAGGAGGG - Intronic
903414713 1:23174291-23174313 CAGAACAAAAAAGAGGAGGAAGG - Intronic
903982215 1:27197368-27197390 GAGAGGAAACGGCAGGAGGAAGG - Intergenic
904045100 1:27603958-27603980 GAGAGCAGAAGGCAGGAGGAGGG - Intronic
904087077 1:27916760-27916782 AGGAGGAAAGAGGAGGAGGAAGG - Intergenic
904272050 1:29356545-29356567 CAGAGCTAAGAGAAGGAAGGAGG + Intergenic
904440255 1:30525332-30525354 AAGAAGAAAGAGGAGGAGGAGGG + Intergenic
904625752 1:31800998-31801020 CAGAGCTTTGAGCAGGAGGAGGG - Intronic
904650492 1:32002305-32002327 CAGAGGAAAGAACAGAAAGAGGG - Intergenic
905791009 1:40789533-40789555 GAGTGCAAGGAGGAGGAGGAAGG - Intronic
906103024 1:43275171-43275193 AAGAGAAAAGAGCAGAAGCAGGG - Intergenic
906155992 1:43614269-43614291 CAGAGCACAGGGCAGCAGGCAGG - Intronic
906387232 1:45380644-45380666 CAGAGCAAAGAGAAAGAATAAGG + Intronic
906472097 1:46139671-46139693 AAGAGGAAAGACGAGGAGGATGG - Intronic
906687563 1:47772324-47772346 CAGAGAGAGGAGCAGGACGAAGG + Intronic
906722688 1:48020520-48020542 CAGAGTAAAGAGCTCCAGGAGGG + Intergenic
906724668 1:48035578-48035600 CAAAGGAAAGAGCAGGGGGAGGG + Intergenic
906955397 1:50369866-50369888 CAGAGCGAAGAGCAGGTGGGAGG + Intergenic
907115514 1:51964856-51964878 AAGAGCAAAGTGCAGAAGCAGGG - Intronic
907282446 1:53359934-53359956 CTGAGCAAAGAGGTAGAGGAGGG - Intergenic
907629848 1:56069526-56069548 CAGTGGAAAGAGCAGGAGCAAGG + Intergenic
907762820 1:57378121-57378143 CAGAGCTCAGAGCAGGATGGAGG + Intronic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
907913297 1:58846101-58846123 CAGAGGAAACAGCATGGGGAAGG - Intergenic
908462008 1:64355244-64355266 TGGAGCAAAGAACAGGAGGACGG + Intergenic
908641029 1:66223711-66223733 CAGTGCATAGAGAAAGAGGAGGG + Intronic
908668101 1:66514786-66514808 CAGAGGAAAGGGTGGGAGGAGGG + Intergenic
908852042 1:68386489-68386511 TAGAGCAAAGAGCAGGAGGATGG - Intergenic
909507750 1:76413130-76413152 CAGAGGAAATAGGAGAAGGAAGG - Intronic
909793275 1:79701558-79701580 CGGAGCAGAGAGCAGGAGGACGG + Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910144152 1:84058844-84058866 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
910707192 1:90142297-90142319 CAGAGCAAAGAGCAGGAGCTGGG + Intergenic
910766612 1:90788760-90788782 CAGAGCAACTAACAGGAGCAAGG - Intergenic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
912115025 1:106395168-106395190 CAGAGCAAAGGGGATGAGGGTGG - Intergenic
912431370 1:109630131-109630153 CACAGCAGAGGGCAGGGGGAGGG - Intronic
912449749 1:109761571-109761593 CAGAGCAAGGGGCGGGAGGTGGG + Intronic
912531461 1:110326728-110326750 CACAACAAAGAACAGGAGAATGG + Intergenic
912701503 1:111881654-111881676 CAGGGCAAAGGGCAGGGGCATGG + Intronic
913200963 1:116495156-116495178 CGGAGGAAGGAGCAGGAGGAGGG - Intergenic
913242278 1:116839411-116839433 CAGTCAAAAGACCAGGAGGATGG + Intergenic
913282217 1:117197312-117197334 GAGAGCAATGAGAAGGGGGAGGG - Intronic
913477062 1:119248084-119248106 CACTGAAAAGTGCAGGAGGAGGG - Intergenic
914448628 1:147771737-147771759 CAGAGCAGAGAGTACCAGGAGGG - Intronic
914449257 1:147776081-147776103 CAGAGAAAAGGACAGGACGAGGG + Intergenic
914460972 1:147884888-147884910 TAGAACAAAAAGCAGGAGAAAGG + Intergenic
914665923 1:149832499-149832521 CTGAGCAGAGTGGAGGAGGAGGG + Intergenic
914669842 1:149861295-149861317 CTGAGCAGAGTGGAGGAGGAGGG - Intronic
914980606 1:152411317-152411339 CAGCACAAAGAGCAGCAGGTTGG + Intronic
915147240 1:153802413-153802435 GGGAGCATGGAGCAGGAGGAGGG + Intergenic
915984337 1:160448749-160448771 GAGGGCAAGGAGGAGGAGGAGGG - Intergenic
916183292 1:162106269-162106291 GACAGCAAAGAGAAGCAGGATGG - Intronic
916379094 1:164188721-164188743 GAGAGCAGAGGACAGGAGGAGGG - Intergenic
916382210 1:164224530-164224552 CAGGGGGAAGGGCAGGAGGAAGG + Intergenic
916475184 1:165162335-165162357 TAGGGCAAAGAGGAGTAGGAAGG + Intergenic
916685172 1:167137686-167137708 AATGGCAAAGAGCTGGAGGAGGG + Intergenic
916872668 1:168933990-168934012 CAGAGGAAAGGGCGGGAGGTCGG - Intergenic
917247661 1:173022229-173022251 TAGAACAAAAAGGAGGAGGAAGG - Intergenic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917691561 1:177475082-177475104 CAGAGCAAAGTGCAGCAAGCAGG + Intergenic
917977443 1:180249433-180249455 CAAAGCCAAGAGCCGGAGGTGGG + Intronic
918079165 1:181192389-181192411 CAGAGAAAAGAGCTGCAGGGAGG + Intergenic
918346702 1:183613693-183613715 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
918371364 1:183864761-183864783 TAGAGAAAGGAGCAGGTGGATGG + Intronic
918546210 1:185687452-185687474 GAGAGAAAAGAAAAGGAGGAAGG - Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
919734455 1:200937025-200937047 CAGAGCAGAGTGCAGTGGGACGG + Intergenic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920244339 1:204576516-204576538 CAGAGCCGGGAGCAGGAGGATGG + Intergenic
920308773 1:205035769-205035791 CAGAGCTAAGACTGGGAGGAAGG + Intergenic
920503667 1:206501389-206501411 CAGAGCACAGAGGAGGAGACAGG + Intergenic
920508098 1:206531300-206531322 CAGAGCAAAGGGCTGCAGAAAGG + Intronic
920778984 1:208969608-208969630 GATAGCAAAGAGAAGGGGGAGGG + Intergenic
920824651 1:209413993-209414015 CTGAGCAAAGAGAAGGAAAACGG + Intergenic
920829067 1:209449308-209449330 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
920916016 1:210258618-210258640 CAGAGCCAAGATCAGCAGGCAGG + Intergenic
921130827 1:212218209-212218231 CAGAGCAAACAGCACGGGAAAGG - Intergenic
921354926 1:214276912-214276934 CTGAACAAAGTGCAGTAGGAAGG - Intergenic
921671350 1:217927265-217927287 GAGAGCAAAGAGAAGGAGAGTGG + Intergenic
921732529 1:218594112-218594134 TGGAGCAAAGGGCAGGAGGACGG - Intergenic
921733404 1:218599561-218599583 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
921884153 1:220287639-220287661 CAGTGAAAAGTGAAGGAGGATGG - Intergenic
921975592 1:221199536-221199558 GAGGACAAAGAGTAGGAGGAGGG + Intergenic
922006016 1:221531464-221531486 GAGAGAAGAGAGCAGGGGGAGGG - Intergenic
922154365 1:223029628-223029650 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
922204666 1:223436053-223436075 AAGAGGAAAAAGCAGGAGAAGGG + Intergenic
922551690 1:226498769-226498791 AAGAGCAAAGAGAGGCAGGAGGG + Intergenic
922601242 1:226856127-226856149 AAGAGAAAATAGGAGGAGGAAGG - Intergenic
922608172 1:226904137-226904159 CCAAGGAATGAGCAGGAGGAGGG - Intronic
922668229 1:227490665-227490687 CAGAGGGAAGAGGAGGAGGCAGG - Intergenic
923143323 1:231179911-231179933 CTGGGCAAAGAGTAGGAGAAGGG + Intronic
923771021 1:236937420-236937442 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
924350001 1:243105707-243105729 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
924417332 1:243870946-243870968 TAGAACAAAAAGCTGGAGGAAGG + Intergenic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
1062898667 10:1125051-1125073 CAGGGCACAGTGGAGGAGGACGG + Intronic
1063144820 10:3287482-3287504 CAGAACAACGCACAGGAGGAAGG - Intergenic
1063159454 10:3408756-3408778 AGGAGGAAAGAGGAGGAGGAGGG + Intergenic
1063164813 10:3451676-3451698 TAGAGGAAAGAGGAGGAGGGAGG - Intergenic
1063367079 10:5497252-5497274 CAGAGCAAGGGGGAGAAGGACGG - Intergenic
1063982891 10:11470209-11470231 CAGCGCAGAGGGCATGAGGATGG + Intronic
1064218208 10:13417933-13417955 GACAGCAAAGAGAAGGAAGAGGG - Intergenic
1064280684 10:13948591-13948613 CTGAGCAGAGAGCAGGTGGTGGG + Intronic
1065366825 10:24944998-24945020 CAGTGCAAAGCTCAGGAGGCAGG - Intronic
1065856677 10:29836803-29836825 CACAGCAAAGTGCAGCAGCATGG - Intergenic
1066562606 10:36686891-36686913 AAGAGGGAAGAGGAGGAGGAAGG + Intergenic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1067512349 10:46906497-46906519 GAGAGCAAAGAGAAAGAGGATGG + Intergenic
1067649894 10:48145325-48145347 GAGAGCAAAGAGAAAGAGGATGG - Intergenic
1067807149 10:49400664-49400686 GAGAGCACAGCCCAGGAGGAAGG + Intergenic
1067837883 10:49652791-49652813 CAGGGCAAAGGTCAGGAGGCAGG - Intronic
1068398284 10:56493550-56493572 AAGAGCTAAGAGGATGAGGAGGG - Intergenic
1069419326 10:68232139-68232161 TATAGCAAAGAGCTGAAGGAGGG + Intergenic
1069755379 10:70771567-70771589 CAGAGCTGAGAGCAGGAGCTGGG - Intronic
1069821256 10:71230074-71230096 AAGAGCAGAGAGGAGGAGGTAGG - Intronic
1069825019 10:71249678-71249700 CAAAGCACAGAGCAGGTAGAAGG + Intronic
1069854375 10:71431739-71431761 GAGAGAATAGAGCAGGGGGAAGG - Intronic
1069909555 10:71751129-71751151 CTGAGCCCAGAGCAGGAGGGAGG + Exonic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070415882 10:76188831-76188853 CAAACCCAAGAGGAGGAGGATGG + Intronic
1070476810 10:76836841-76836863 GAGGGCAAAGAGGATGAGGAAGG - Intergenic
1070630775 10:78082826-78082848 CAGCCCAAAGAGCAGGAGAGAGG + Intergenic
1070645856 10:78202022-78202044 CAGAGAAAAGAGCTGAAGGACGG + Intergenic
1070796743 10:79221375-79221397 CAGAACAAAGAGCTGGGGGCTGG - Intronic
1071445964 10:85747522-85747544 AAGAGGAAGGGGCAGGAGGAAGG - Intronic
1071877767 10:89861338-89861360 GAGAGGGAAGAGGAGGAGGAGGG - Intergenic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1072578372 10:96720244-96720266 CATAGAAAAGAGCAGAAAGAGGG + Intronic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1073330841 10:102669066-102669088 AAGAAGAAAAAGCAGGAGGAAGG - Intergenic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1073542269 10:104323883-104323905 CACAGTAAAGAGCAGGAAGGTGG - Intronic
1073599949 10:104836847-104836869 GATAGAAAAGAGCAGGAGGTAGG - Intronic
1073703244 10:105954154-105954176 CAAAGGAAAGAACAGGAGGAAGG + Intergenic
1073709718 10:106022576-106022598 CGGAGCAAAGAGCGGGAGGACGG + Intergenic
1074155018 10:110790376-110790398 GAGAGCAAAGAGGAGGAGACAGG + Intronic
1074181521 10:111069211-111069233 AAGAGAAAAGAGCTGGAGAAGGG - Intergenic
1074512432 10:114127954-114127976 CAAAGCAGAGAGGAGGAGGAAGG + Intronic
1074614545 10:115054103-115054125 GAGGGCAAAGAGGAAGAGGAGGG - Intergenic
1074672200 10:115804455-115804477 AAGAGCAAAGAGCAGGAGCCAGG - Intronic
1074899105 10:117801518-117801540 CAGAGGAAAGGGCAGCAGGGGGG - Intergenic
1075248435 10:120845451-120845473 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1075840647 10:125499525-125499547 CAGAGCACAGAGCTGCAGGCAGG + Intergenic
1075909353 10:126110489-126110511 AAGAGCAAAGAGAAAGAGAACGG + Intronic
1075942978 10:126407190-126407212 GGGTCCAAAGAGCAGGAGGAAGG + Intergenic
1076005715 10:126947072-126947094 TGAGGCAAAGAGCAGGAGGAAGG - Intronic
1076006347 10:126950696-126950718 TGAGGCAAAGAGCAGGAGGAAGG - Intronic
1076030137 10:127150336-127150358 CTGAGCAAAGAGAAAGGGGAGGG - Intronic
1076114608 10:127886585-127886607 GAGAGAAAAGGGCAGGAGGAGGG + Intronic
1076180293 10:128401827-128401849 CTGGGCATGGAGCAGGAGGAGGG + Intergenic
1076273167 10:129174488-129174510 CAGAGCAGAAAGAAGGAGGCAGG - Intergenic
1076686219 10:132199602-132199624 CAGTGCGGACAGCAGGAGGAGGG - Intronic
1076704766 10:132295090-132295112 CAGTGCACAGAGCAGGTGCACGG + Intronic
1077010468 11:377047-377069 GAGGGCGAAGAGGAGGAGGAAGG + Exonic
1077332535 11:1989779-1989801 TAGAGGGAAGAGGAGGAGGACGG + Intergenic
1077534685 11:3117972-3117994 AAGAGAAAATAGTAGGAGGAAGG - Intronic
1078128137 11:8588049-8588071 GAGAGGACAGAGCAGGAAGATGG - Intronic
1078139342 11:8680860-8680882 GTGACCAAAGAGTAGGAGGAAGG + Intergenic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1078914717 11:15768674-15768696 AAGAGGAAAGAGCAGGACAAAGG - Intergenic
1078941428 11:16010675-16010697 GAGAGCAGAGAGAAAGAGGAGGG + Intronic
1079043573 11:17080245-17080267 CAGTGCCAACAGCAAGAGGAAGG - Intronic
1079378840 11:19918903-19918925 CAGAGCATAAAGCAGAAGGAAGG - Intronic
1079445555 11:20553592-20553614 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1079459198 11:20665263-20665285 AAGTGCAAAGATCATGAGGATGG + Intergenic
1079672874 11:23189219-23189241 TGGAGCAAAGAGCAGGCGGATGG + Intergenic
1080159778 11:29159912-29159934 AAGAGAAAAGAGGAGGAGGATGG + Intergenic
1080689877 11:34547627-34547649 CAGAGCAAAGACCAGGCCAAAGG - Intergenic
1080894730 11:36439730-36439752 GAGAACAAAAAGGAGGAGGAAGG - Intronic
1080907539 11:36561628-36561650 TAGAACAAAAAGGAGGAGGAAGG + Intronic
1081806011 11:45890929-45890951 CTGAGCAGAGGGCAGGAAGATGG + Intronic
1081914432 11:46721644-46721666 CAGAACACAGTGCAGGAGGGAGG - Intronic
1082160516 11:48883798-48883820 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082161850 11:48896608-48896630 CTGAGCAAAGAGGAGGGGGTGGG + Intergenic
1082167435 11:48965053-48965075 CTGAGCAAAGAGGAGGAGGTGGG + Intergenic
1082236127 11:49821606-49821628 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082239585 11:49856152-49856174 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082242569 11:49888199-49888221 CTGAGCAAAGAGGAGGGGGTGGG + Intergenic
1082609630 11:55281526-55281548 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082657055 11:55869002-55869024 CTGAGCAAAGAGAAGGGGGTGGG + Intergenic
1082757052 11:57087731-57087753 GAGAGCAGAAAGCAGGAGGGAGG + Intergenic
1082821690 11:57548288-57548310 CAGAGGAAACAGCAGGTGCAAGG - Intronic
1083146973 11:60767278-60767300 CAGAGCAGAAAACAGGAGGCAGG + Intronic
1083262359 11:61530206-61530228 AAGAGCAAGGCGCAGGTGGAAGG - Intronic
1084014200 11:66369139-66369161 CAGGGCAAAGAGCAGCAGTATGG + Exonic
1084023781 11:66435204-66435226 CAGAGAAGAGAGCAGGAGTTGGG - Exonic
1084347671 11:68566313-68566335 AGGAGGAAAGAGAAGGAGGAAGG - Intronic
1084370210 11:68736784-68736806 GAGAACAAAGAGGAGGAGGAGGG + Intronic
1084582523 11:70032805-70032827 CAGAACACATAGGAGGAGGAGGG + Intergenic
1085042479 11:73334755-73334777 CAGACCCAGGAGCAGGGGGAAGG - Intronic
1085300322 11:75454600-75454622 CAGACCAGGGAGCAGGAGCAAGG + Intronic
1085645389 11:78219164-78219186 CAGAGTAGAGAGGAGGTGGATGG + Exonic
1085702240 11:78755640-78755662 AGGAGCAGAGAGCAGGAGCAGGG - Intronic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1085750651 11:79158080-79158102 CAGCCCAGAGTGCAGGAGGAGGG - Intronic
1085763762 11:79264488-79264510 CAGAGCTTAGAGCAGGGGGACGG - Intronic
1086000236 11:81974766-81974788 AAGAGAAAAGAGCAAGAGGGAGG - Intergenic
1086125542 11:83345113-83345135 TGGAGCAAAGAGCAGGAGGATGG + Intergenic
1086134976 11:83436043-83436065 CAGAGCAAAGAGCAGGACAGGGG + Intergenic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1086469641 11:87094514-87094536 CAGAGGAAAGACTAGGCGGAGGG - Intronic
1087070938 11:94079831-94079853 CAGAGCATGCAGCAGGATGAAGG + Intronic
1087196594 11:95309940-95309962 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1088363498 11:109016141-109016163 TAGAGCAAGGAGCCAGAGGAAGG + Intergenic
1088919542 11:114251186-114251208 GGGAACAAAGAGCTGGAGGAGGG - Intergenic
1089071164 11:115700700-115700722 CAGAGGGAAGAACGGGAGGAGGG + Intergenic
1089139242 11:116273089-116273111 GGGAGCAAAGGGAAGGAGGAAGG + Intergenic
1089304394 11:117517540-117517562 CAGAGGAGAGGGCAGGAGGGTGG + Intronic
1089359585 11:117876865-117876887 GCGAGCACAGAGCGGGAGGACGG - Exonic
1089376756 11:118000059-118000081 CAGAGCTTCCAGCAGGAGGAAGG + Exonic
1089884540 11:121806928-121806950 CTGAGCGAAGAGCATGGGGATGG + Intergenic
1090096828 11:123750569-123750591 CAGATCCAAGAAAAGGAGGAAGG - Intergenic
1090128323 11:124113678-124113700 CACACCAATGAGCAGGAAGAGGG + Intergenic
1090238548 11:125166144-125166166 CAGAGCAGAGGGCTGGAGGTCGG + Intronic
1090350136 11:126102736-126102758 CCTAGCAAGGAGCAGGAGGCAGG + Intergenic
1090460312 11:126885720-126885742 CAGAGCAGAGGGCAGCAGGCTGG + Intronic
1090464997 11:126925732-126925754 CAGAGAGAAGTGCAGGAGCAGGG - Intronic
1090501217 11:127263241-127263263 CTGGGCAAAGGGCAGAAGGAGGG + Intergenic
1090705207 11:129329878-129329900 GAGAGGAGAGAGCAGGAAGAGGG + Intergenic
1090731509 11:129576702-129576724 AAGAGCACAGGGTAGGAGGAAGG - Intergenic
1090800451 11:130168202-130168224 AAGAGCAAACAGAATGAGGAAGG + Intronic
1090806083 11:130203179-130203201 CAGGGCAAAGAGCTGGATGGGGG + Intronic
1090872235 11:130758614-130758636 TGGAGCAAAGAACAAGAGGACGG + Intergenic
1091121082 11:133058192-133058214 CAAACCATAGAGGAGGAGGAAGG + Intronic
1091196185 11:133732742-133732764 CAGGGCTCAGAGCAGCAGGAGGG - Intergenic
1202815516 11_KI270721v1_random:44955-44977 TAGAGGGAAGAGGAGGAGGACGG + Intergenic
1091384015 12:80817-80839 CTGAGCAAAGTCCTGGAGGAGGG + Intronic
1091406837 12:214433-214455 AAGGGCAAGGAGGAGGAGGAGGG - Intronic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1092071668 12:5636554-5636576 GAGAGAAAACAGCAGGTGGAAGG + Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092695220 12:11164257-11164279 TAGAACAAAAAGCTGGAGGAAGG + Intronic
1092713508 12:11363758-11363780 AAGAGAAATGAGCAGGAGCAAGG + Intronic
1092714368 12:11373293-11373315 AAGAGAAATGAGCAGGAGGAAGG + Intronic
1092717219 12:11402974-11402996 AAGAGAAATGAGCAGGAGCAAGG + Intronic
1092860063 12:12712609-12712631 CAAAGCAAGGAGAAAGAGGAAGG - Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093578437 12:20763410-20763432 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1093584787 12:20822113-20822135 CGGAGCAAAGAGCAGGAGGACGG + Intronic
1093650086 12:21633386-21633408 CAGAGCCAAGAGCTGGAAGAAGG - Intergenic
1093850034 12:24025181-24025203 GAGAGCAAAGTTGAGGAGGATGG + Intergenic
1094106486 12:26817215-26817237 CAAAGCACAGAGCTAGAGGAAGG + Intronic
1094329422 12:29275004-29275026 TGGAGCAAAGAGCAGGAGGACGG - Intronic
1094383174 12:29865755-29865777 CAGAGAAAAGAGCAGATGCAAGG + Intergenic
1095519545 12:43046291-43046313 GAGAGTAGAGGGCAGGAGGAGGG + Intergenic
1096242606 12:49967387-49967409 CACAGCCATGACCAGGAGGATGG + Intronic
1096262998 12:50104535-50104557 CACAGGAAAGTACAGGAGGAGGG - Intronic
1096805912 12:54141032-54141054 CAGAGGCCAGAGCAGGAGGGAGG + Intergenic
1097384640 12:58934754-58934776 GAGTGGGAAGAGCAGGAGGAGGG - Intergenic
1097398248 12:59102127-59102149 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1098095522 12:66951368-66951390 CAGAGCAAATAGCAGCACAAAGG + Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098394420 12:70003088-70003110 CAGAGGAGAGAGGAGGAGGGAGG + Intergenic
1098504854 12:71237612-71237634 TAGAAAAAAGAGGAGGAGGAGGG - Intronic
1098511018 12:71314242-71314264 CAGACCAAAGAACAGTGGGAAGG - Intronic
1098574564 12:72026621-72026643 GAGAAGAAAGAGCAGGAGGAAGG - Intronic
1098785973 12:74756290-74756312 CAGAGAAAAGGGTGGGAGGAGGG - Intergenic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1099194409 12:79598201-79598223 CAGTGCAAACATCAGGAGGTAGG + Intronic
1099872585 12:88368523-88368545 CGGAGCAAAGAGCAGGACAGGGG - Intergenic
1100315585 12:93441819-93441841 CAGAGCGAAGAGCTGGAGGCCGG + Intronic
1101084902 12:101225956-101225978 CTAAGCAATGAGAAGGAGGAGGG - Intergenic
1101234392 12:102774258-102774280 CTGAGCAGAGAGCAGCAGCAGGG + Intergenic
1101850415 12:108397457-108397479 CAGTGCAAAGGCCAGGAGGCAGG + Intergenic
1102173346 12:110858810-110858832 CAGAGCAAAGGGGAGGAGTTGGG + Intronic
1102216511 12:111165272-111165294 CTGAGAAAAGAGAAGTAGGAAGG + Intronic
1102422532 12:112815195-112815217 CAGGGCACAGAGCAGGATGGAGG + Intronic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1103162840 12:118744492-118744514 GAGAGAAAAGAGAAAGAGGAAGG + Intergenic
1103425656 12:120831041-120831063 CAGAACAAAAAGGCGGAGGAAGG + Intronic
1103478193 12:121233587-121233609 AAGAACAGAGAGGAGGAGGAGGG + Exonic
1103795207 12:123498623-123498645 CAGACCAAGGAGCAGGAGATGGG - Exonic
1103896725 12:124278086-124278108 CAGAGCACGGAGCTGGAGGGAGG + Intronic
1104014515 12:124953039-124953061 CACAGCGAATGGCAGGAGGATGG + Intronic
1104174478 12:126316638-126316660 AACAGCAAAGAGGGGGAGGAGGG + Intergenic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1105260744 13:18777476-18777498 CAGAGCACAGAACTGGAGGCTGG - Intergenic
1105299841 13:19123302-19123324 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
1105579165 13:21677319-21677341 AAGAGCAAAGAAAAGAAGGAAGG - Intronic
1105772667 13:23627625-23627647 GAGAGCGAAGGGCAGGAGGGAGG + Intronic
1105899399 13:24742581-24742603 CAGAGCAGACAGGAGCAGGAGGG - Intergenic
1105899964 13:24745574-24745596 CACAGCAAGGACCAGGAGCACGG + Intergenic
1105900171 13:24746438-24746460 CACAGCAAGGACCAGGAGGACGG - Intergenic
1106041896 13:26101488-26101510 CACAGAAAAGAGGAGGAGCAAGG + Intergenic
1106174797 13:27321014-27321036 CAGGGCTGAGAGCAGGAGGCTGG + Intergenic
1106538357 13:30667893-30667915 AAGAAAAAAGACCAGGAGGAAGG + Intergenic
1106666863 13:31860433-31860455 CAGAAGAAAGAAAAGGAGGATGG - Intergenic
1106672628 13:31922897-31922919 CACAGCACAGAGCAGCAGGGAGG - Intergenic
1106776084 13:33011157-33011179 CAGAGTAACGAGCAGGGAGATGG + Intergenic
1106780781 13:33057081-33057103 CCCAGTAAAGAGGAGGAGGAAGG - Intronic
1106943183 13:34799408-34799430 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1107025835 13:35800522-35800544 CAGAGCAAAGGGCAAGAATACGG + Intronic
1107397228 13:40030444-40030466 CAGAGCACAGAGCAGTGTGACGG - Intergenic
1107584565 13:41830891-41830913 AAAAGAAAAGAGGAGGAGGAAGG + Intronic
1107649125 13:42526524-42526546 CAGATCAAAGAGAAAGAGGCAGG + Intergenic
1107827500 13:44342030-44342052 GAGAACAAAAAGCAGGAGGAAGG + Intergenic
1107879706 13:44822305-44822327 GAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1108092099 13:46859633-46859655 CATGGCCCAGAGCAGGAGGAAGG - Intronic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1108319210 13:49271277-49271299 GGGAAAAAAGAGCAGGAGGAAGG + Intronic
1108426207 13:50303975-50303997 GAGGGTAGAGAGCAGGAGGAAGG - Intronic
1108950245 13:56083614-56083636 CCGAGAAAATAGCAGAAGGAGGG + Intergenic
1109175199 13:59146468-59146490 CAGAGAAAAGAGCAAGATGATGG + Intergenic
1109478759 13:62919738-62919760 CAGAGCAGACACCAGGAGCAGGG + Intergenic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1110593490 13:77292257-77292279 CAGAGCAAGCAGCAGGAAAAAGG - Intronic
1111126297 13:83913339-83913361 TGGAGCAAAGAGCAAGAAGACGG + Intergenic
1113109065 13:106802542-106802564 CAGAGCTAAGGCCAGGAGGTAGG + Intergenic
1113321995 13:109243015-109243037 TAGAACACAGAGGAGGAGGAAGG + Intergenic
1113323970 13:109265571-109265593 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1113374374 13:109750546-109750568 GAAAGCAAAGATCGGGAGGATGG + Intergenic
1113802890 13:113095686-113095708 CAGGGCCTGGAGCAGGAGGACGG - Intronic
1113812044 13:113148921-113148943 CGGAACACGGAGCAGGAGGAGGG + Exonic
1113852121 13:113423798-113423820 CAGAGCAAAGGACAAGATGACGG + Intronic
1113933465 13:113980916-113980938 GAGAGGAGTGAGCAGGAGGATGG + Intronic
1114657353 14:24324077-24324099 CATGGCAAAGACAAGGAGGATGG + Exonic
1114954160 14:27796712-27796734 AGGAGCAAAGAGCAGAAGGTTGG - Intergenic
1115231471 14:31165411-31165433 CAGAGAGAAGAACTGGAGGAAGG - Intronic
1115240921 14:31250598-31250620 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
1115519696 14:34221127-34221149 GAGAGCAGAGAGCAAGAGGAGGG + Intronic
1116179370 14:41516372-41516394 TGGAGCAAAGAACAGGAGGACGG - Intergenic
1116435276 14:44888818-44888840 CAGTGCAAAGAGCATCACGATGG - Intergenic
1116573189 14:46544519-46544541 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116952614 14:50893662-50893684 TGGAGCAAAGAGCAGGAGGATGG - Intronic
1116967041 14:51025774-51025796 TAGAGTAAAGAACAGGATGAAGG + Intronic
1117206623 14:53450075-53450097 CAGGGCAAAGAGGAGATGGATGG + Intergenic
1117644490 14:57837321-57837343 CAGCGAAAAGAGCAGAAGGGAGG + Intronic
1117667319 14:58070200-58070222 CAGCTCAAAGAGGAGGAAGAAGG + Intronic
1118461066 14:65987501-65987523 CATTGCAAAGAGTGGGAGGAGGG + Intronic
1118730516 14:68662891-68662913 CAGAGCAGTGGGGAGGAGGATGG - Intronic
1119147200 14:72328129-72328151 TAGAACAAAAAGAAGGAGGAGGG - Intronic
1119187398 14:72652434-72652456 CACAGCAGAGACCAGAAGGATGG + Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119476773 14:74934977-74934999 CAGAGAAGAGAGAAGGAGAAGGG + Intergenic
1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG + Intergenic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1120871383 14:89340082-89340104 GAGAGGAAAGAGAAGAAGGAAGG + Intronic
1121085011 14:91139251-91139273 GAGAACAAGGAGGAGGAGGAAGG - Intronic
1121312214 14:92941327-92941349 CACAGTAGAGAGCAGGCGGACGG + Exonic
1121333073 14:93060048-93060070 GAGACCAGAGGGCAGGAGGAGGG + Intronic
1121523864 14:94604810-94604832 GAGAGCTAAGAGTTGGAGGAAGG - Intronic
1121706684 14:96001704-96001726 GAGAGCAAAGAGAAGCAGGATGG + Intergenic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1121760006 14:96436772-96436794 CAGAGAGAAGGGAAGGAGGAGGG - Intronic
1121832763 14:97066124-97066146 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1122234748 14:100325293-100325315 CTGGGCAAAGGCCAGGAGGAGGG - Intronic
1122325787 14:100880075-100880097 CAGAGCTCAGGGCAAGAGGAAGG + Intergenic
1122392789 14:101401803-101401825 AAGAGGAAAGAGAAGGAGAAGGG - Intergenic
1122406375 14:101503513-101503535 GAGAGAAAAGAGCAAGAGGCCGG - Intergenic
1122623044 14:103070603-103070625 CAGAACAAAGAGGAGGAGAGAGG - Intergenic
1122625881 14:103085175-103085197 GAGAGCAGAGACCAGCAGGATGG - Intergenic
1122943093 14:104991811-104991833 CAAAGCCTAGAGCAGGAGGTGGG + Intronic
1123793987 15:23753384-23753406 CAGTGTGCAGAGCAGGAGGAGGG + Intergenic
1123954022 15:25314872-25314894 CAGAGCAAAGATCATTAGCAAGG - Intergenic
1124112691 15:26806821-26806843 CAGAGCATGGGGCAGGAGGTGGG + Intronic
1124718587 15:32091753-32091775 CATAGCAGAGTGCAGGAGTATGG - Intronic
1125045436 15:35239112-35239134 CGGAGCAAAGAGCAGGAGGACGG - Intronic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125405920 15:39352625-39352647 GAAAGCACAGAGCTGGAGGATGG + Intergenic
1125511840 15:40296408-40296430 GAGGGCAAAGAAGAGGAGGATGG + Intronic
1125516156 15:40322587-40322609 GAGAGCAGAGAGCGGAAGGAGGG + Intergenic
1126201538 15:45992207-45992229 CAGAGCTGAGGGCAGGGGGAAGG + Intergenic
1126335387 15:47581663-47581685 CAGAGCAAAGGACAGGGGGTTGG + Intronic
1126443869 15:48720204-48720226 CAGAGAGAAGATCTGGAGGAAGG + Intronic
1126694027 15:51310813-51310835 CAGAGGAAAGAGGGGGAGAAAGG + Intronic
1127058248 15:55154358-55154380 CAGAGCAGAGAACATGAGAAGGG - Intergenic
1127364854 15:58279249-58279271 CAGTGCTCAGAGCAGCAGGATGG - Intronic
1127939333 15:63678073-63678095 GAGAGCAAAGAGGAAGAGAAAGG - Exonic
1128349271 15:66878180-66878202 CAGAGAGAAGAGGAGAAGGAGGG + Intergenic
1128557712 15:68642860-68642882 CACAGCAAGGAACAGGAGGTTGG + Intronic
1128715363 15:69903823-69903845 CAGGGCAGAGAGCAAGATGAAGG - Intergenic
1128886386 15:71292175-71292197 CAAAACAAAGAGCATCAGGATGG - Intronic
1129109514 15:73329427-73329449 GTGAGGGAAGAGCAGGAGGAGGG - Intronic
1129153120 15:73701567-73701589 TAGAGGAAACAGCAGGTGGAAGG - Intronic
1129337137 15:74859398-74859420 CAGAGCAAAAAACAGGAAGAAGG + Intronic
1129771017 15:78203702-78203724 AAGAGCAGAGAGCGGGAGGCTGG + Intronic
1130022273 15:80241574-80241596 CAGAGCAAAGCAAAGGAGAATGG - Intergenic
1130102747 15:80906248-80906270 CCCAGAAAAGAGCAAGAGGAGGG + Intronic
1130165850 15:81457276-81457298 CAGACCCAAGAGCAGTAGCAAGG - Intergenic
1130271687 15:82454170-82454192 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1130408507 15:83624421-83624443 AAGCGCAAAGAGCAGGAAGCGGG + Intergenic
1130464035 15:84181557-84181579 CAATGGAAAGAGCAGGAGAAGGG + Intronic
1130474836 15:84255487-84255509 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1130482252 15:84369543-84369565 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1130488649 15:84413276-84413298 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1130500232 15:84491984-84492006 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1130507787 15:84562463-84562485 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1130560639 15:84955645-84955667 CAGAGCACAGAGCCCCAGGAGGG + Intergenic
1130586331 15:85186189-85186211 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1130832724 15:87617873-87617895 CATAGCAGAGAACAGGAGGCAGG - Intergenic
1131561762 15:93449807-93449829 CAGAACAAAGAGGCAGAGGATGG - Intergenic
1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG + Intergenic
1132043068 15:98541480-98541502 CAGATTAAAGATCTGGAGGATGG - Intergenic
1132428119 15:101737776-101737798 CAATGGAAAGAGCAGGAGAAGGG - Intronic
1132919584 16:2379363-2379385 CAGAGCACACAGCAGCACGAAGG - Intergenic
1133118631 16:3592721-3592743 CAGAGCTAAGGCCAGGAGGAAGG + Exonic
1133356475 16:5140633-5140655 AAAAGCAAAAACCAGGAGGAAGG - Intergenic
1133392805 16:5422947-5422969 GGGAGGAAAGAGGAGGAGGAGGG + Intergenic
1133392843 16:5423057-5423079 GGGAGGAAAGAGGAGGAGGAAGG + Intergenic
1134286205 16:12864165-12864187 CTTGACAAAGAGCAGGAGGAGGG + Intergenic
1134692038 16:16197493-16197515 CAGAGGGAAGAGAGGGAGGACGG + Intronic
1135352462 16:21740578-21740600 AAAAGCAGAGAGCAGGAGGCAGG - Intronic
1135450950 16:22556700-22556722 AAAAGCAGAGAGCAGGAGGCAGG - Intergenic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1135947939 16:26881977-26881999 CAAAGCAGAGAGCAGAAGGGTGG - Intergenic
1136266981 16:29127656-29127678 CTAAGCAAAGAGCAGGGGCAGGG + Intergenic
1136360767 16:29778221-29778243 CACAATAAAGGGCAGGAGGAGGG + Exonic
1136554074 16:30997545-30997567 CAAAGCATTGAACAGGAGGAGGG - Exonic
1136983721 16:35081709-35081731 CAGGGCACAGAGCAAGAGGCTGG - Intergenic
1137507376 16:49065878-49065900 TAGAAAAAAGAGCAGGTGGAAGG - Intergenic
1137703994 16:50520929-50520951 CAGAGCAGAGGTCAGGATGAAGG - Intergenic
1138033652 16:53580613-53580635 CAGAGCAAAGCACAGCAGGCAGG - Intergenic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1138804591 16:60079037-60079059 CGGAGCAAAGAGCGGGAGGGCGG - Intergenic
1139478886 16:67217334-67217356 CAGAGCCAGGACTAGGAGGAAGG - Intronic
1140123380 16:72101757-72101779 CAGTGAAGAGACCAGGAGGAAGG - Intronic
1140266116 16:73422690-73422712 TAGAGCAAAGAGGCAGAGGAAGG - Intergenic
1140357666 16:74320002-74320024 CAGAGAAGAGTGCAGGAGAAAGG - Intergenic
1141332730 16:83126943-83126965 AAGAGCAAATGGCAGGATGAAGG + Intronic
1141636610 16:85317330-85317352 GAGAGCCAAGAGGAGAAGGAGGG - Intergenic
1141916151 16:87098694-87098716 CAGAGCAAATATCCCGAGGAAGG + Intronic
1142070269 16:88087979-88088001 CTAAGCAAAGAGCAGGGGCACGG + Intronic
1142644027 17:1300663-1300685 CAGAGCACAGAGCAGGAGAAGGG + Exonic
1142646220 17:1315534-1315556 CAAAGCAAAGGTCAGGAAGACGG - Intergenic
1143393885 17:6576704-6576726 CAGGGCCAACAGCAAGAGGAAGG - Intergenic
1143481342 17:7229217-7229239 CAGAGCAATGAGCGGGGAGACGG - Exonic
1143714188 17:8755408-8755430 CAGAGTAAAGAGGAGAAGTAGGG + Intronic
1143923564 17:10349994-10350016 TAGAGCACAGGGCAGCAGGAAGG - Intronic
1144104331 17:11972239-11972261 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1144431464 17:15196022-15196044 CTAAGCAAAAAGCAAGAGGAAGG + Intergenic
1144486137 17:15665936-15665958 CTGAGAAAAGAACATGAGGAGGG - Intronic
1144802567 17:17940577-17940599 CTGAACAAAGAGCAGGAATAAGG + Intronic
1145796585 17:27659000-27659022 AAGAGCAAAAGGCAGGAAGAAGG + Intergenic
1145811020 17:27764277-27764299 AAGAGCAAAAGGCAGGAAGAAGG + Intronic
1146132191 17:30287880-30287902 CAGAGAAAGGAGCCTGAGGATGG - Exonic
1146329063 17:31912458-31912480 CAGGGCAAAGTGCAGGAAAAAGG + Intergenic
1146450021 17:32965414-32965436 AAGATCAAGGGGCAGGAGGAAGG + Intergenic
1146529100 17:33592690-33592712 CGGACCAAAGTGAAGGAGGAGGG + Intronic
1146535984 17:33652617-33652639 GAAAGCAAATAGCAGAAGGAGGG - Intronic
1146659698 17:34657536-34657558 CAGGGCAAAGGGCAGAAGGGAGG - Intergenic
1146903912 17:36605882-36605904 GAGAGCCAAGAGCAGAAGAAAGG - Intronic
1146916856 17:36683481-36683503 CAGATTACAGAGCAGGAGGCTGG - Intergenic
1146935862 17:36812430-36812452 CAGTGCAAAGGCCTGGAGGAGGG - Intergenic
1146947232 17:36882155-36882177 GAGACAAAAGAGCAGGTGGAGGG - Intergenic
1147399019 17:40168016-40168038 CAGCACAAAGCTCAGGAGGATGG - Intronic
1147498792 17:40942407-40942429 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1147632392 17:41940439-41940461 AAGAGGAAAGGGCAGGAGGCAGG - Intronic
1148546382 17:48522319-48522341 CAGAGCCAACAGGAGGAGGCTGG + Intergenic
1148698185 17:49573588-49573610 GGGAGCACAGAGCGGGAGGAGGG - Intergenic
1148783961 17:50136172-50136194 CAGAGCCTGGAGCAGGAGAAGGG - Exonic
1148999170 17:51739478-51739500 CAGAGTCAAGTGGAGGAGGATGG + Intronic
1149381461 17:56098183-56098205 TAGAGCCTAGAGAAGGAGGATGG + Intergenic
1150129964 17:62663765-62663787 CAGTGCAAGGGGCAGGGGGAAGG + Intronic
1150138578 17:62709987-62710009 CAGAGCAAAAAGCAGCAGGAGGG - Intronic
1150437465 17:65165115-65165137 CAGAGCAGACAGGAGGAAGAAGG - Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1151268819 17:72977627-72977649 AAGAGCAAAGAGCAGAGAGAGGG + Intronic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1151652103 17:75476398-75476420 AAGAGGAAAGAGAAGGAGGGAGG - Intronic
1151840015 17:76611011-76611033 CACAGCAAAGAGCAGGAGGATGG + Intergenic
1152042745 17:77915072-77915094 CAGAGAAAAGGGCAGGAGGATGG - Intergenic
1152106889 17:78335437-78335459 CAGAGAAGAGGGCAGGAGGGAGG - Intergenic
1152278175 17:79370076-79370098 CAGAGCAGGGAGCATCAGGAAGG - Intronic
1152367467 17:79864881-79864903 CAGAGGCCACAGCAGGAGGAGGG - Intergenic
1152501015 17:80709044-80709066 CAGAGCAGAGACCTCGAGGAAGG + Intronic
1152655106 17:81515630-81515652 CAGGGCAAGGAGCTGGAGGTGGG - Intronic
1153987791 18:10368595-10368617 GAGAGCAGAGAGAGGGAGGAAGG + Intergenic
1154092404 18:11378098-11378120 GAGGGCAAAGAGGAGAAGGAGGG + Intergenic
1154975432 18:21452819-21452841 CAGAAAAAAGAACAGGAGAAAGG + Intronic
1155012321 18:21792180-21792202 CACAGCAAGGTGGAGGAGGAAGG - Intronic
1155105942 18:22666582-22666604 AAGTCCAAAGGGCAGGAGGAAGG - Intergenic
1155450415 18:25957520-25957542 CAGGGCAAAGAGAAATAGGAAGG - Intergenic
1155697326 18:28698377-28698399 TGGAGTAAAGAGCAGGAGGACGG + Intergenic
1156466103 18:37348641-37348663 AAAAGCCAAGACCAGGAGGAGGG - Intronic
1156472271 18:37384661-37384683 CAGAGCAAAGTGAAGGTGGTAGG + Intronic
1156812946 18:41274238-41274260 CAGGGGAAAGAGTAGCAGGAGGG + Intergenic
1156961298 18:43034908-43034930 CAAGGCACAGAGGAGGAGGAAGG - Intronic
1157439131 18:47696878-47696900 CAGGGCAAAGAGGAGGGGGTGGG - Intergenic
1157660980 18:49443671-49443693 GAGAGCAATGAGCAGGAAAATGG + Intronic
1158336050 18:56415935-56415957 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1158423136 18:57313545-57313567 CAGAAGGAAGAGGAGGAGGAAGG + Intergenic
1158723187 18:59944149-59944171 TTGAGCTAAGAACAGGAGGAAGG - Intergenic
1159123117 18:64192882-64192904 AAAAGCAAAGTGCAGAAGGAAGG + Intergenic
1159705973 18:71688192-71688214 CACAGCAAAGAGAAGGGGAAAGG + Intergenic
1159900381 18:74039490-74039512 CACAGCCAGGAGCAGGAGGAAGG - Intergenic
1159959661 18:74545653-74545675 AACAGCAGAGAGGAGGAGGAGGG - Intronic
1160849506 19:1183613-1183635 CAGAGCAAAGGGCCGGGGGCAGG + Intronic
1160851361 19:1194514-1194536 CAGGGCAAGAGGCAGGAGGAGGG - Intronic
1160859388 19:1231209-1231231 GAGAGCACGGAGCAGGAGGAGGG - Exonic
1161001922 19:1914873-1914895 CAGAGCACAGGGCACGATGAAGG + Intronic
1162794254 19:13078462-13078484 CTGGGCAAGGAGCAGCAGGAGGG + Intronic
1163497021 19:17652535-17652557 CAGCCCAGAGAGGAGGAGGAGGG - Intronic
1164211940 19:23106207-23106229 AAGAAAAAAGAGGAGGAGGAAGG + Intronic
1164574853 19:29399925-29399947 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
1164591913 19:29512082-29512104 GAGAGCAAGGATGAGGAGGAAGG + Intergenic
1164868676 19:31625758-31625780 GAGAGGGAAGAGGAGGAGGAGGG - Intergenic
1164937041 19:32223150-32223172 AAGAGAAAAGAGGAGGAGAAAGG + Intergenic
1164937051 19:32223225-32223247 GAGAGAAAAGAGGGGGAGGAAGG + Intergenic
1165096323 19:33411748-33411770 CACTGCAAAGAGCCGGGGGAGGG + Exonic
1165494301 19:36142617-36142639 GAGAGCTCAGAGCAGGGGGAGGG - Intronic
1165497276 19:36160506-36160528 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1165510615 19:36264719-36264741 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1165730792 19:38143370-38143392 CACTGCAAGGAGGAGGAGGAAGG - Intronic
1166121937 19:40691512-40691534 CAGAGAAAAGAGCTGGGGGAAGG + Exonic
1166921059 19:46229534-46229556 CATAGCACAGAGAAGGTGGAGGG + Intergenic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167173391 19:47848827-47848849 CAGAGGAAACAGCTGGGGGAAGG - Intergenic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167504406 19:49863556-49863578 CACAGCAAAAAACAGAAGGAGGG + Intronic
1167839848 19:52106778-52106800 AAGAGAAAATAGCAGGAGGAAGG - Intergenic
1168000566 19:53442623-53442645 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
1168005061 19:53480107-53480129 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
1168228270 19:55011945-55011967 CAGAGCAAAGAGCAAGACAGGGG + Intergenic
1168433809 19:56302326-56302348 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
1168569424 19:57453133-57453155 AAAAGAAAAGAGCAGGAGGGAGG - Intronic
1168599656 19:57707688-57707710 GGGAACAAAGAGCAGGGGGAAGG - Intronic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925207128 2:2016279-2016301 CAGAACACAGAGCAAGAAGATGG + Intronic
925383747 2:3447464-3447486 GAGAGAGAAGAGGAGGAGGAGGG + Intronic
925406175 2:3606585-3606607 CAGAGCAAGGAGCAGGGGCTGGG - Intronic
925436889 2:3846203-3846225 AAGAGGGAAGAACAGGAGGACGG - Intronic
926122669 2:10253435-10253457 CAGAGCAAGGAGCGAGAGGCAGG - Intergenic
926314057 2:11696793-11696815 CAGAGCATGAAGCAGCAGGAAGG - Intronic
926377017 2:12240703-12240725 CAGAGGAAAGAGAAGGAACATGG - Intergenic
926407446 2:12570159-12570181 CAGAGCAAAGGGCAGGAGGAAGG - Intergenic
926413268 2:12626821-12626843 CGGAGCAAAGAGTAGGAGTACGG - Intergenic
926418635 2:12675537-12675559 CATAGCTGTGAGCAGGAGGAAGG - Intergenic
927045687 2:19275955-19275977 CAGGGCAGAGAGCAGAAAGAAGG - Intergenic
927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG + Intergenic
927518370 2:23685178-23685200 CAGGGCAGAGGGCAGGAGGGAGG - Intronic
927723901 2:25406024-25406046 GAGAGGGAAGAGCAGGAGGCTGG + Intronic
927890291 2:26743876-26743898 CAAAGCAAATAGCAGTAGCAGGG - Intergenic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
928105803 2:28469991-28470013 GAGAAGAAAGAGGAGGAGGAGGG + Intronic
928413154 2:31069961-31069983 CCGAGAGAAGAGGAGGAGGATGG + Intronic
928886232 2:36151706-36151728 AAGAGCTAAGAGCAGAAGCAGGG + Intergenic
928902755 2:36338264-36338286 CAGAGCTATGAGCAGGAGTCAGG - Intergenic
929094563 2:38251186-38251208 CAGAGCCTAGAGTTGGAGGATGG - Intergenic
929222893 2:39483733-39483755 CAGAGAGAAGAGGAAGAGGAAGG - Intergenic
929992657 2:46802827-46802849 TAGAGCAGAAAGCAGGAGGTCGG - Intergenic
930084071 2:47480240-47480262 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
930743844 2:54860883-54860905 CAGAGCAAAGAGGTTTAGGATGG - Intronic
931209427 2:60178556-60178578 CAGAGCAAAGCACAGGAGTGGGG + Intergenic
931722487 2:65077429-65077451 CAGAGCAAAGACATGGAGGGAGG + Intronic
931732425 2:65165132-65165154 CAGAGCAGAAAGGAGGAGCAAGG - Intergenic
932102663 2:68914823-68914845 CAGATTAGAAAGCAGGAGGAGGG - Intergenic
932359161 2:71090473-71090495 TGGAGCAAAGAGCAGGAGGATGG + Intergenic
932406395 2:71515588-71515610 AGGAGGAAAGAGCAGGAGGAAGG - Intronic
932502701 2:72197979-72198001 CAGAGCAAAGAGGAGAATGTTGG + Intronic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
932796553 2:74700799-74700821 CAGAACAAAGGACAGAAGGAAGG + Intergenic
932974266 2:76579180-76579202 CGGAGCAAAGAACAGGAGGACGG + Intergenic
933012767 2:77088726-77088748 AGGAGCAAAGAGCAGGAGGACGG - Intronic
933078979 2:77965618-77965640 TGGAGCAAAGAACAAGAGGAAGG - Intergenic
933161119 2:79026213-79026235 CAGAGCCAAGAAAAGGAGGAAGG + Intronic
933174394 2:79159264-79159286 CAGAGCTAACAAGAGGAGGAAGG - Intronic
933236645 2:79871556-79871578 CAGAACAAAAAGGTGGAGGAAGG - Intronic
933329825 2:80879722-80879744 GGGAGCAAAGAGCAGGAGGACGG + Intergenic
933552653 2:83793999-83794021 CAGAGCAAAGAACAGGAGGATGG + Intergenic
933812626 2:86042593-86042615 CAGAGGGAAAGGCAGGAGGAAGG + Intronic
933893124 2:86789265-86789287 CAGAGCCAAGGGCAGGAGCGGGG + Intronic
934483102 2:94672255-94672277 AGGAGCAAAGAGCAGGAGGTTGG + Intergenic
934712053 2:96522747-96522769 CTGAGCAAAGGGCAGGAGGCAGG + Intergenic
934855353 2:97725855-97725877 AAGTGCAAAGATCAGGAGGCAGG + Intronic
935079486 2:99778199-99778221 CAGAGGAAGGAGGAGGAGAAGGG - Intronic
935733804 2:106089829-106089851 CAGAGCAAAGAGTGGGGGTAGGG + Intergenic
935977768 2:108595994-108596016 GAGAGCAAAGATCAGGAGTAAGG + Intronic
936135382 2:109888523-109888545 GAGAGCAAAGATCAGGAGTAAGG + Intergenic
936209315 2:110482962-110482984 GAGAGCAAAGATCAGGAGTAAGG - Intergenic
936267819 2:111023708-111023730 CAGAACACAGGGCTGGAGGAAGG + Intronic
936428501 2:112438201-112438223 GAGAGCAGAGATCAGGAGTAAGG - Intergenic
937004678 2:118500810-118500832 AATAGGAAGGAGCAGGAGGAGGG + Intergenic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937223530 2:120355473-120355495 CAGAGCCAAGGGCAGGAGTTGGG - Intergenic
937237026 2:120437224-120437246 GAGATAAAAGAGCAGGAGAAGGG + Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937876993 2:126833207-126833229 GGAAGCAAAGAGCAGGAGAAAGG + Intergenic
938187552 2:129245210-129245232 CAGAGAGATGAGCAGGAAGAGGG - Intergenic
938287984 2:130134574-130134596 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
938427604 2:131204303-131204325 CAGAGAGAAGAGAAAGAGGAAGG + Intronic
938468541 2:131538325-131538347 CAGAGAGAAGAGAAAGAGGAAGG + Intergenic
938576099 2:132606046-132606068 CAGAGCAGCAAGCGGGAGGAGGG + Intronic
939168136 2:138661678-138661700 CAGAGCATAGAGCAAGAGAGTGG - Intergenic
939259211 2:139785042-139785064 TAGAGCAAAGAAGAGGAGCATGG - Intergenic
940676107 2:156725362-156725384 CAGAGCAAAGAACAGGACAGGGG + Intergenic
941035942 2:160569492-160569514 CACAGCAAGGAGCAGCAGCAGGG - Intergenic
941216592 2:162717459-162717481 AAGAGCAGTGAGCAGGAGGCTGG - Intronic
941340105 2:164296310-164296332 TGGAGCAAAGAGCAGGAGGATGG - Intergenic
941440116 2:165524207-165524229 CAATTCAAATAGCAGGAGGAGGG + Intronic
941628384 2:167856261-167856283 AAGAGCAAAAAGCAGAAGGAAGG + Intergenic
941994182 2:171585980-171586002 TAGAGCAGAGAACAGAAGGAGGG - Intergenic
942115745 2:172727273-172727295 CAGAGGAAAGAGCAGACAGAGGG + Intergenic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
942196571 2:173526656-173526678 CTGAGCAAAAAGAAGGAGGCTGG - Intergenic
942307939 2:174627134-174627156 CAGAGCACAGTGGTGGAGGATGG - Intronic
942644532 2:178095934-178095956 CAGAGCACAGAGCAGCAGTGGGG + Intronic
943183936 2:184580798-184580820 CAGAATAAAGAACAGGAGGAAGG - Intergenic
943325551 2:186493391-186493413 AAGAGAAAAGAGCAGGTAGAAGG - Intronic
943449896 2:188033964-188033986 CGGAGCAAAGAGCAGGACGGGGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
945398314 2:209348794-209348816 CAAAGCAGACAGCAGGAGGGAGG - Intergenic
946236501 2:218327517-218327539 GAGAGCAGAGAGCAGCAGGGAGG - Intronic
946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG + Intronic
946451118 2:219780309-219780331 CAGGGCAAATATCAGGAGAAAGG + Intergenic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
947389486 2:229624268-229624290 AAGAGAAAAAAGCAGGAAGATGG + Intronic
947636945 2:231684981-231685003 CACAGCGAGGAGGAGGAGGATGG + Intergenic
947731734 2:232435068-232435090 CAGGGCCCAGGGCAGGAGGAAGG - Intergenic
947954724 2:234178809-234178831 GGGATCAAAGAGTAGGAGGAGGG + Intergenic
948457629 2:238114225-238114247 CAGAGCCATGGGGAGGAGGAAGG - Intronic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
948549945 2:238764623-238764645 CAGAGCCAAGTGAAGGAGGGAGG + Intergenic
948916829 2:241038779-241038801 GAGAGCACTGAGCAAGAGGAAGG - Intronic
1168805531 20:670310-670332 CAGAGCAGAAAGTAGGAGGCCGG - Intronic
1168976482 20:1969803-1969825 CAGAGAGAAGAGCAAGAGCAAGG - Intergenic
1169384978 20:5141077-5141099 GAGAGAAAGGAGCAGGAGAAAGG - Intronic
1169827640 20:9787334-9787356 CAGTGCAAAGACCTGGAGGTGGG - Intronic
1170069146 20:12345434-12345456 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1170165583 20:13358382-13358404 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1170215820 20:13889913-13889935 CTGAGCACAGAGCAAGATGATGG + Intronic
1170356318 20:15495939-15495961 AAGAGGAAAGAGCATGAGCAAGG + Intronic
1170994685 20:21341253-21341275 CTGAGGCAAGAGGAGGAGGATGG + Intronic
1171078286 20:22151459-22151481 CAGAACAAAAAGATGGAGGAAGG - Intergenic
1172361626 20:34316628-34316650 AGGAGCAGAGAGAAGGAGGAGGG + Intergenic
1172586631 20:36089893-36089915 GGGAACAAAGAGAAGGAGGAAGG - Intergenic
1172765982 20:37351129-37351151 CAGAGCAAGGAGTAGGGAGATGG - Intronic
1173118576 20:40269552-40269574 CAGAGCAAAGAGCAGGACAGGGG - Intergenic
1173140921 20:40482124-40482146 AAGAGCACAGTCCAGGAGGATGG - Intergenic
1173179795 20:40797178-40797200 CAGGGCTAAGAGCATGAGGGAGG + Intergenic
1174405324 20:50299067-50299089 AGGAGGAAAAAGCAGGAGGAGGG + Intergenic
1175051655 20:56161135-56161157 CAGAGGAAAGAGCAAGTGCAAGG - Intergenic
1175225536 20:57441874-57441896 CAGAGGAATGGGCAGGGGGAGGG + Intergenic
1175375644 20:58521849-58521871 CACAGCAAGGGGCAGGGGGATGG + Intergenic
1175446336 20:59022827-59022849 CAGAACTGAAAGCAGGAGGAAGG - Exonic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1176670351 21:9728371-9728393 AAGAGCAAAGAGAGGGAAGAGGG + Intergenic
1178156182 21:29856803-29856825 CAGCACAAAGAACAGGAGGATGG + Intronic
1178491387 21:33054631-33054653 CAGAGCCAAGACCAGGATCAGGG + Intergenic
1178721713 21:35016591-35016613 CAGAAGAAGGAGCAGGATGAGGG - Intronic
1178924324 21:36762338-36762360 CAGAGAAGAGAGCAGGGGTAGGG + Intronic
1179070256 21:38064464-38064486 CAAAGCCAGGAGCAGGAGGTGGG - Intronic
1179217274 21:39378382-39378404 CAAAACAAAGAGCAGGAGTCTGG - Intergenic
1179218984 21:39389811-39389833 CAGAGCAAGGTGCAGGTGCAGGG - Intronic
1180244625 21:46538920-46538942 CAGGACAAAGGGCAGGAGGGTGG - Intronic
1180560608 22:16611797-16611819 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1180638441 22:17279109-17279131 CAGTGCAAAGAGCAAGGGAAGGG - Intergenic
1180718450 22:17888591-17888613 CTGAGAAAAGAGTAGGAGGTGGG + Intronic
1181085768 22:20438670-20438692 AACAGCACAGAGCAGAAGGAAGG + Intronic
1181103222 22:20555352-20555374 CAGGGCTAGGAGGAGGAGGAGGG - Intronic
1181324892 22:22037107-22037129 AAGAGGGAAGAGTAGGAGGAAGG + Intergenic
1181423474 22:22817967-22817989 CAGAGCAAAGGGCAGGGAGGGGG - Intronic
1181508449 22:23377584-23377606 GAGAAGAAAGAGGAGGAGGAAGG + Intergenic
1181528211 22:23502050-23502072 CAGAGGAAAGGGCAGGTGGTGGG - Intergenic
1181647667 22:24242606-24242628 CAGAAAAAAGAGCAGGAGACTGG + Intronic
1181863821 22:25839966-25839988 CTGAGCAGAGAGCTGAAGGAGGG - Intronic
1181928946 22:26383801-26383823 CTGAGCTAAGAGAGGGAGGATGG - Intergenic
1181965491 22:26653754-26653776 CAGAGCAAAGGGGAAGAGAAGGG - Intergenic
1182015790 22:27038648-27038670 CAGAGGAAACAGCAGGTGCAAGG + Intergenic
1182137213 22:27917928-27917950 CTGAGCAAAGACCTGGAAGAAGG + Intronic
1182355669 22:29721286-29721308 CAGAGCAGAGGGCAGGGGCAGGG + Intronic
1182570213 22:31231632-31231654 CAAAGTAAAGAGCAGGATTAAGG - Intronic
1182680270 22:32074051-32074073 CACTGCAATGAGCAGGAGGGTGG + Intronic
1182888494 22:33796706-33796728 CAGAGCCAGGTGGAGGAGGAGGG + Intronic
1183022005 22:35034868-35034890 CAGTGCAAAGATCCGGAGGCAGG + Intergenic
1183279291 22:36923482-36923504 CAGAGGACAGAGGAGGAGGGAGG + Intronic
1183433490 22:37780133-37780155 CAGAGCTGAGAGCAGGGGGACGG - Intergenic
1183730895 22:39617811-39617833 CAAGGGAAGGAGCAGGAGGAGGG - Intronic
1184101994 22:42345573-42345595 CAGAGCTAAGTCCAGGAGGTGGG + Intergenic
1184499159 22:44861546-44861568 CAGAGCAGAGAACTGGAGGGAGG - Intronic
1184662844 22:45973342-45973364 CACAGCACAAAGCAGGAAGATGG + Intronic
1184832775 22:47000261-47000283 GCGAGCAGAGAGCTGGAGGAGGG + Intronic
949146187 3:702299-702321 CAGTGCAAACAGCATGTGGAAGG - Intergenic
949190624 3:1244549-1244571 AGGAACAAAGAGCAGGAGGACGG + Intronic
949276859 3:2294107-2294129 AAGAGCAAAGAGCAGAAGCAAGG + Intronic
949356600 3:3187055-3187077 CAGAGCAATGAGCAGTTGGTAGG + Intergenic
950126898 3:10515085-10515107 CAGAGCATAGAGCAGGGGCTTGG + Intronic
950183985 3:10933876-10933898 CAGAATAAAGAGCAGCAGGAGGG - Intronic
950363426 3:12466113-12466135 CAAAGCAAAGAGCATCTGGATGG - Intergenic
950419826 3:12892396-12892418 CGATGCACAGAGCAGGAGGAGGG - Intergenic
950967206 3:17154650-17154672 CAGAGCTGAGGGCAGGAGGTAGG + Intergenic
951431946 3:22618394-22618416 AAGAGGAAAGAGAAGAAGGAAGG + Intergenic
951558556 3:23945012-23945034 GAGAGGAAAGAGGAGGAGGAGGG + Intronic
952216253 3:31280529-31280551 CATAGCAAAGAGCAGCTGTAGGG - Intergenic
952257978 3:31711925-31711947 AATAGCAAAGGCCAGGAGGAAGG + Intronic
952711788 3:36439101-36439123 CAGTGGAAAGAGCATGGGGACGG + Intronic
952964819 3:38614675-38614697 AAGAGAAAAGGGCAGGATGAGGG + Intronic
952991198 3:38832481-38832503 CTGAGCCGAGAGCAGGAGAATGG - Intergenic
953955203 3:47226688-47226710 AAGAGAAAGGAGCTGGAGGAGGG + Intergenic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
954537510 3:51372343-51372365 CAGGGCAGAGGGCAGGGGGAGGG + Intronic
954613005 3:51956120-51956142 CCGAGCAGCGAGCAGGAGCAGGG - Exonic
954630390 3:52044836-52044858 AAGAGGAGAGAGCAGGATGAAGG - Intergenic
954707935 3:52491013-52491035 CAGGGCTCAGAGCAGGAGGTAGG + Intronic
955644935 3:61126974-61126996 CCAAGAAAAAAGCAGGAGGAAGG + Intronic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
957733602 3:84177521-84177543 GAGGGCAGAGAGTAGGAGGAAGG + Intergenic
958675660 3:97265529-97265551 CAGAGCAAGGACCAGGAGTAGGG + Intronic
958906602 3:99948621-99948643 GAGAGGAAGGAGGAGGAGGAGGG + Intronic
958953629 3:100442938-100442960 AAGAGAAAATAGGAGGAGGAAGG + Intronic
959268749 3:104177321-104177343 GAGAGTGGAGAGCAGGAGGAGGG - Intergenic
959321898 3:104887170-104887192 CAGAGCCCATAGCAGGAGGAGGG + Intergenic
959808870 3:110592698-110592720 CAGAGCAAAGGGCCGGGGGATGG - Intergenic
959972563 3:112422840-112422862 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
960221385 3:115113456-115113478 CAGTGCCAAAAGCAGGAGGCAGG - Intronic
960627983 3:119700287-119700309 TATAGCAAAGAGCAGGCTGAGGG + Intergenic
960715033 3:120566716-120566738 AAGAGAAAGGAGCGGGAGGAGGG - Intergenic
960807499 3:121598216-121598238 CAGAGCAAAGTGCATAAGGGTGG + Intronic
961730292 3:128960301-128960323 CGGAGCAAAGAGCAGGAGGACGG - Intronic
961786609 3:129351102-129351124 CAGAGGAAACAGCATGAGCAAGG - Intergenic
961809592 3:129514252-129514274 CAGAGGAAAGACCGTGAGGAAGG - Intronic
962306048 3:134287285-134287307 CAGTGCAATGAGCAGGGGGATGG - Intergenic
962800839 3:138889255-138889277 CATGGCAAAGAGGATGAGGAAGG + Intergenic
962826992 3:139107579-139107601 CAGAGCAAGGTGGAGGAGGTGGG + Intronic
962876997 3:139542731-139542753 CAGAGAGATGAGGAGGAGGAAGG + Intergenic
963115385 3:141724595-141724617 CAGAGCAAAGAGGATGAGAGAGG + Intergenic
963329531 3:143898733-143898755 GAGAGTAGAGGGCAGGAGGATGG + Intergenic
964577415 3:158188480-158188502 CAGATGATAGAGCAGGAAGAGGG - Intronic
964602989 3:158523769-158523791 GAGAGGAATGAGCAGGAGCATGG + Intronic
965690053 3:171346148-171346170 CAGATGAAACAGCAGGAAGAAGG + Intronic
966085146 3:176061801-176061823 CGGAGCAAAGAGCAGGACAGGGG - Intergenic
966278931 3:178207905-178207927 CAGAACAAAGAGCAGGACAGGGG + Intergenic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
966954355 3:184858607-184858629 GAGAGCAATGAGCAGGAACATGG + Intronic
966958564 3:184910093-184910115 CAAAGAAAAGAGAAAGAGGAAGG - Intronic
967149878 3:186638744-186638766 CAGAACAAAGAGGAGGAGAATGG - Intronic
967229642 3:187325264-187325286 CAGAGAAAAGAGGGGGTGGAAGG + Intergenic
967727028 3:192871671-192871693 CAGAGCCAAGAGAATGAAGAGGG + Intronic
968382936 4:110601-110623 CAGAGCAAAGGGCAAGGGGGAGG + Intergenic
968488023 4:873586-873608 CAGCACAAAGGGCAGAAGGAGGG - Intronic
968544103 4:1187710-1187732 GATAGCACAGAGGAGGAGGAGGG - Intronic
968691385 4:1992122-1992144 CACAGCAGAGCGCAGGAGCAGGG + Intronic
968715229 4:2153160-2153182 GAGAGCAAAAAGCAAGAGGCAGG + Intronic
969199308 4:5589971-5589993 TAGAGAAAAGAGAAGGTGGAGGG + Intronic
969247101 4:5942265-5942287 TAGAGCTAAGATCAGGAGCAGGG + Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969469834 4:7381323-7381345 CGGAGCACAGAGCTGGAGGGCGG + Intronic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
969692899 4:8715435-8715457 CAGAAAATAGAGGAGGAGGAAGG - Intergenic
969727780 4:8934091-8934113 AAGAGAAAATAGGAGGAGGAAGG - Intergenic
970072840 4:12181692-12181714 CAGAGCAAAAAGGTAGAGGAGGG + Intergenic
970103544 4:12554305-12554327 CACAGTAAAGAGCAGTAGAAAGG - Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
970860573 4:20698186-20698208 CAGAGCAAATAACAGGACAAAGG + Intronic
971178095 4:24300952-24300974 CAGATGAGAGAGCAGAAGGATGG + Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971199826 4:24501477-24501499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
972092244 4:35301659-35301681 CAGACAAAAGAGCAGCAGCAGGG - Intergenic
972156784 4:36172892-36172914 CACAGAAAGGAGCAGCAGGATGG - Intronic
972770056 4:42189417-42189439 CAGAGAAAAGAGGATAAGGAGGG - Intergenic
972983910 4:44740652-44740674 CAGAACAAAAATCCGGAGGAAGG + Intergenic
973245318 4:48004633-48004655 AAGAGAAAATAGGAGGAGGAAGG + Intronic
973559919 4:52124923-52124945 CAGAGCACAGAGCAGGGAGAAGG - Intergenic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
974512827 4:62866957-62866979 TAGAACAAAGAGAAGGAGCAAGG + Intergenic
975193133 4:71489936-71489958 CAGGGAAAAGAGCAGGAGAGAGG + Intronic
975836648 4:78429358-78429380 CATAGAAATGGGCAGGAGGAAGG - Intronic
975954535 4:79821896-79821918 CATAGCAAAGAGCAGGAAGAAGG + Intergenic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
977005868 4:91569233-91569255 CAGAGCAATGAGAAGGAACATGG - Intronic
977041710 4:92026292-92026314 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
977060995 4:92256669-92256691 AAGTGCAAGGAGCAGGAGAAGGG + Intergenic
977174183 4:93798951-93798973 CAGAGAAAAAAGCAGGGGGTAGG + Intergenic
977666990 4:99653662-99653684 GAGAGAAAATATCAGGAGGAGGG - Exonic
977745174 4:100538475-100538497 CAGAGAAATGAGCAGGAGGGTGG + Intronic
978001411 4:103558969-103558991 CAGAGCAAAGTGTAGGAGGACGG + Intergenic
978125362 4:105129298-105129320 CAGAGCCAAGAGCAGACTGAAGG - Intergenic
978712946 4:111807655-111807677 AAGAGAAAAAAGCAGGAGGTCGG + Intergenic
978738318 4:112109394-112109416 CAAAGAAAATAGCAGGAAGATGG - Intergenic
979005656 4:115292619-115292641 CAGAACACAGAGCAGGGGAAGGG - Intergenic
979251941 4:118574840-118574862 AAGGGGAAAGAGCAGCAGGAGGG - Intergenic
979887305 4:126045316-126045338 TAGAGCAAAAAGATGGAGGAAGG + Intergenic
980225152 4:129974041-129974063 TAGAACAAAAAGGAGGAGGAAGG - Intergenic
980234594 4:130089562-130089584 AAGAGCAACTATCAGGAGGAGGG + Intergenic
980312216 4:131145783-131145805 CAGGGCAAAGAGTGGGAGGGGGG + Intergenic
980388620 4:132118642-132118664 TGGAGCAAAGAGCAGGAGGATGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980581769 4:134763471-134763493 AAGAGCAAAAAGTGGGAGGAAGG - Intergenic
980612083 4:135172615-135172637 GGGAGCAAAGAGCAGGAGGATGG + Intergenic
981157070 4:141450820-141450842 CAGGACAAAGAAGAGGAGGAAGG - Intergenic
981242329 4:142492708-142492730 CAAAGCATAGAAAAGGAGGAAGG + Intronic
981936819 4:150248262-150248284 CAGACCACAGAGGAGGAGAAAGG - Intronic
982174048 4:152688740-152688762 CAGGGCACGGAGGAGGAGGAGGG + Intronic
982346617 4:154367279-154367301 CAGACCGAAGAGCAGCAGGGTGG + Intronic
982535123 4:156600696-156600718 TGGAGCAAAGAACAGGAGGATGG - Intergenic
983055200 4:163093654-163093676 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983286489 4:165746270-165746292 CAGTACAAAGAGCATGAAGATGG + Intergenic
983360086 4:166716627-166716649 CGGAGCAAAGAACAGGAGGACGG - Intergenic
983658713 4:170110101-170110123 AATAGGAAAGAGTAGGAGGAAGG + Intergenic
983659288 4:170116889-170116911 CAGAACAAAGAGTAGGAGGACGG - Intergenic
983710075 4:170704040-170704062 GAGAGCAGAGGGTAGGAGGAAGG - Intergenic
984002194 4:174262993-174263015 CAGAGAGCAGAGCAGGAGAATGG - Exonic
984189579 4:176589354-176589376 AAGAGTACAGAGCAGAAGGAAGG + Intergenic
984473201 4:180203482-180203504 CTGAGAAAAGAGTAGGAGGGAGG + Intergenic
984700316 4:182814793-182814815 TGGAGTAAAGAGCAGGAGGACGG - Intergenic
984881381 4:184412707-184412729 CCAAGCAAGGAGCAGAAGGAAGG - Intronic
984999438 4:185469953-185469975 CAGAGCACGGGGCAGGAGAAGGG - Intronic
985329993 4:188821521-188821543 CAGAGGGAAGAGCAAGAGCACGG + Intergenic
985404426 4:189623163-189623185 AAGAGCAAAGAGAGGGAAGAGGG - Intergenic
985522906 5:387225-387247 CAGAGGAGAGAGCAGGAGACAGG - Intronic
985699341 5:1361121-1361143 GAGGGCAGAGGGCAGGAGGAGGG + Intergenic
986088785 5:4481094-4481116 GAGTGCAAAGAGGAGGTGGACGG - Intergenic
986283831 5:6345593-6345615 CAGAGAACAGAGGAGGAGGGAGG + Intergenic
986502369 5:8414542-8414564 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
986739805 5:10696113-10696135 AATAGGGAAGAGCAGGAGGAGGG - Intronic
986858820 5:11903744-11903766 CAGCGGCAAGAGGAGGAGGACGG + Intronic
986905490 5:12490372-12490394 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
986919895 5:12667810-12667832 CAGAGCAAAGAACAGGAGGACGG + Intergenic
987528818 5:19088422-19088444 TAGAACACAGAGGAGGAGGAGGG - Intergenic
987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG + Intergenic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988232057 5:28492026-28492048 CAGGGCAAAAGGTAGGAGGAGGG + Intergenic
988238108 5:28573334-28573356 CAGTTCAAAGTGGAGGAGGATGG - Intergenic
988731574 5:33977762-33977784 CAGAGCACAGAGAATGTGGAAGG + Intronic
988873539 5:35417977-35417999 CAGAGGGAAGAGGAGGAGAATGG - Intergenic
989142325 5:38213879-38213901 TAGAGAAAAGAGAATGAGGAGGG + Intergenic
989398470 5:40983820-40983842 CACAGGAAAGGGCAGGAAGATGG - Intergenic
989852412 5:46230707-46230729 CAGAGTAAAAAACTGGAGGACGG + Intergenic
990300623 5:54445989-54446011 TAGAACAAAAAGGAGGAGGAAGG + Intergenic
990609572 5:57443963-57443985 CAGAGATAAGAGCAGGCTGAGGG - Intergenic
990805953 5:59662094-59662116 CAGGGTAAAGAGCAAGAGGCTGG - Intronic
991458560 5:66832147-66832169 CAGAGCAAAGCACCAGAGGATGG - Intronic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
992178738 5:74176011-74176033 CTGAGCAGAGAGCAGGAGAGCGG - Intergenic
992813989 5:80418252-80418274 AAGAGCAAAGAGGAGGGGAAAGG - Intronic
992962563 5:81971164-81971186 CAGGGCAAAGGGCTGGAGGAAGG - Intergenic
993038702 5:82787481-82787503 CAGAGTAAAAAGGTGGAGGAAGG + Intergenic
993378900 5:87183170-87183192 CAGAGTAAAGGGGATGAGGAGGG + Intergenic
993413570 5:87600354-87600376 CAGAGCATTGAGAAGGAGCATGG - Intergenic
993431983 5:87842964-87842986 GAGAGCTAACAGCAGTAGGAAGG - Intergenic
993836359 5:92824225-92824247 TGGAGCAAAGAGCAGGAGGATGG - Intergenic
994532897 5:100989721-100989743 TGGAGCAAAGAGCAGGAGGAGGG + Intergenic
995008960 5:107236239-107236261 CAGAGTATAGAGCAAGAAGAGGG - Intergenic
995095440 5:108230565-108230587 CAGAGGAAAGGGTAGGAGGGGGG + Intronic
995152396 5:108864425-108864447 CAGAGCAAAGAGCAGAGAAAAGG - Intronic
995253549 5:110019885-110019907 CAGAGCACTGAGAAGGAGTATGG + Intergenic
995749494 5:115439172-115439194 CAGACAAAAGAGCACCAGGAGGG - Intergenic
995806909 5:116063557-116063579 CAGAGTAAAGAGCATGCTGAAGG + Intergenic
995831023 5:116356403-116356425 CAGATCAGAGACCAGGAGAATGG + Intronic
996116461 5:119625430-119625452 CAGAAAGAAGAGGAGGAGGAGGG - Intronic
996440600 5:123486011-123486033 CAGATGTAAGAGGAGGAGGAGGG - Intergenic
997590669 5:135070224-135070246 CAGTCCAAAGACCAGGAGCAGGG - Intronic
997746126 5:136301885-136301907 TGGAGCAAAGAGCAGGAAGACGG - Intronic
997846029 5:137286683-137286705 CAAATCACAGAGCAGGAGGGTGG + Intronic
997872373 5:137516956-137516978 CAGAGGCAAGTTCAGGAGGAGGG + Intronic
997964522 5:138346843-138346865 GAAAGCGAAGAGGAGGAGGAGGG + Exonic
998165804 5:139842881-139842903 CAGAGGAAGGAGGAGGAGAAAGG - Exonic
998198346 5:140096426-140096448 CAGAGCTAAAAGGAGCAGGAGGG + Intergenic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
999034811 5:148335627-148335649 CAGAGCCAAGAGTAGGACTATGG - Exonic
999258185 5:150221559-150221581 CAGGGCAGAGAGGAGGAGGGAGG - Intronic
999451945 5:151685180-151685202 TAGAGCAAAGAGGGGGAGGGAGG - Intronic
999477342 5:151912664-151912686 CAGAGCCAATAGAAGGAGGATGG + Intronic
999585856 5:153088820-153088842 CAGAGCAAAGGGCACCAGGAAGG + Intergenic
999619156 5:153454893-153454915 CGGAGCAAAGAACAGGAGTACGG + Intergenic
1000049278 5:157547999-157548021 TAGAACAGAGAGCAGGAGGAAGG - Intronic
1001121097 5:168980514-168980536 CAGAGCAAAGATTAGGATCAAGG + Intronic
1001138611 5:169123980-169124002 GAGAGGAATGAGCAGGAGCATGG - Intronic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1003400300 6:5785150-5785172 CAGAGGATACAGCAGGAGAAGGG + Intergenic
1003514134 6:6804310-6804332 TAGGGCAAGGGGCAGGAGGAGGG + Intergenic
1003756576 6:9127838-9127860 CAGAGCAAAGAGGATGAGAAAGG - Intergenic
1003850658 6:10219129-10219151 GAGAGGAAAGAGGAGAAGGAGGG - Intergenic
1003957123 6:11174391-11174413 CTGAGCAAAGCGCATGAGGGAGG - Intergenic
1003988383 6:11460931-11460953 CATAGCTAAGAGCAGCAGTAGGG - Intergenic
1005083491 6:21980792-21980814 CAGAGCAGGGAGGAGGAGGTGGG - Intergenic
1005214983 6:23515324-23515346 CAGAGGAAACAGCAGTAAGAGGG - Intergenic
1005487000 6:26310085-26310107 CAGAGAAAAGAGCAAGAAGCGGG + Intergenic
1005529678 6:26690133-26690155 GAGTGCAAAGATCATGAGGAAGG - Intergenic
1005541118 6:26811514-26811536 GAGTGCAAAGATCATGAGGAAGG + Intergenic
1005921528 6:30406213-30406235 CAGGGGAAAGAGCAGGCAGAAGG - Intergenic
1006017562 6:31094440-31094462 CCCAGCAGAGAGCAGGAGCAGGG + Intergenic
1006101394 6:31688309-31688331 CAGAGAACAGAGCAGTGGGAAGG + Intronic
1006113383 6:31762262-31762284 AAGGGCAAAGTGCTGGAGGAAGG - Intronic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1006372226 6:33652191-33652213 TGGAGGAAAGAGCAGGAGGTGGG - Intronic
1006640372 6:35486405-35486427 GAGGGCAGAGAGCAGGGGGAAGG + Intronic
1006743750 6:36326869-36326891 CAGAGCCCAGAGCAGGGGGAGGG + Intronic
1006846756 6:37067550-37067572 GAGAGGAATGAGCAGGAGCATGG - Intergenic
1007221823 6:40284687-40284709 CAGAGCAGAAAGGAGAAGGAAGG - Intergenic
1007772648 6:44203474-44203496 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
1007941982 6:45789898-45789920 AAGAGGAGAGAACAGGAGGAAGG + Intergenic
1008627530 6:53332551-53332573 CACAGAACGGAGCAGGAGGAGGG + Intronic
1009011930 6:57853599-57853621 GAGTGCAAAGATCATGAGGAAGG + Intergenic
1009397453 6:63215834-63215856 CAGAGCAAAGTGCTGGGGGCTGG - Intergenic
1009535581 6:64878863-64878885 CAGAGCAATGACCAAGAGGCTGG - Intronic
1009901634 6:69813956-69813978 CAGAGCAGAGTGGAGAAGGATGG + Intergenic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010535113 6:77017227-77017249 CAGAGGAAACAGCAAGAGAAGGG + Intergenic
1010827206 6:80487635-80487657 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1011744600 6:90397290-90397312 CAGAGCAATTAGCAGGAGGGAGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012150764 6:95748422-95748444 CAGAAAACAGAGCAGGAGTAAGG - Intergenic
1012627963 6:101427306-101427328 CAGAGCAATGAGAATGGGGATGG - Intronic
1012811079 6:103959059-103959081 CACAGCAGAGAGAAAGAGGAAGG + Intergenic
1012963197 6:105644469-105644491 CACAGCAGAGTGTAGGAGGATGG + Intergenic
1013459985 6:110365524-110365546 CAGAGCAAATAGGGGAAGGAAGG - Intergenic
1013460508 6:110370861-110370883 GAGAGGAATGAGCAGGAGCATGG - Intergenic
1013558363 6:111280317-111280339 CAGAGCAGAGGGCAGCAGGTTGG - Intergenic
1013604940 6:111738929-111738951 GGGAGAACAGAGCAGGAGGAGGG - Intronic
1013891383 6:115032295-115032317 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1014089242 6:117384816-117384838 CAGATTAGAGGGCAGGAGGAAGG + Intronic
1014472623 6:121835100-121835122 CAGAGAAAACAGCAGGAACAAGG - Intergenic
1014645547 6:123968236-123968258 GAGAGCAAAGAGAAAGAGGTGGG + Intronic
1014891269 6:126849326-126849348 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1015547470 6:134376196-134376218 CATAGCATAGAGAAGGAGCATGG - Intergenic
1016518505 6:144923658-144923680 CGGAGCAAAGAGCAGGAGGATGG - Intergenic
1016634820 6:146275971-146275993 GAGAAGAAAGAGGAGGAGGAAGG + Intronic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1016874246 6:148849059-148849081 CAGAACAAAAAGGAGGAGGAAGG - Intronic
1017462963 6:154668398-154668420 AAGAAGAAAGAGGAGGAGGAAGG + Intergenic
1017509384 6:155100261-155100283 TGGAGCATAGAGCAGGAGGCAGG + Intronic
1017872595 6:158499774-158499796 CAGAGCCAAGCTGAGGAGGAGGG - Intronic
1018090318 6:160340888-160340910 CAGAGAAAAGCCCAGGAGAATGG - Intergenic
1018549666 6:164981303-164981325 CAGAGCAGAGAGAAGGGGAAAGG + Intergenic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1019020706 6:168915301-168915323 GACAGCAGAGAGCAGCAGGAGGG + Intergenic
1020451595 7:8325964-8325986 AAGAGCAAAGGCCATGAGGAAGG - Intergenic
1021083071 7:16386292-16386314 CAGACAAAAGAGCAGCAGAATGG - Intronic
1021290233 7:18834572-18834594 AGGAGAAAAGAGCAGGAAGAAGG + Intronic
1021313246 7:19117433-19117455 CGGAGGAGAGAGCAGGAGGACGG + Exonic
1021717121 7:23470396-23470418 AAGAGAAAGGAGGAGGAGGAGGG + Exonic
1021823917 7:24528212-24528234 CAAAGCAAGGACCAGCAGGAGGG + Intergenic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022340109 7:29459885-29459907 AAGAGGAAAGAGGAGCAGGACGG + Intronic
1022372596 7:29785441-29785463 TGGAGCAAAGAGCAGGAGGACGG - Intergenic
1022415278 7:30171951-30171973 CAGAGCAGTGAGCAGGAGCCTGG - Intergenic
1022467254 7:30660378-30660400 CAGGGCATCGAGCATGAGGAAGG + Intronic
1022710322 7:32843027-32843049 TGGAGCAAAGAGCAGAAGGAGGG + Intergenic
1023122796 7:36926159-36926181 CAAGGCAAAGAGGTGGAGGAAGG + Intronic
1023158758 7:37277536-37277558 AAGAGGGAAGAGCAGGAGTAAGG + Intronic
1023337653 7:39186935-39186957 CAGAACACAGAGCAGGCGGCAGG - Intronic
1023404708 7:39820617-39820639 AAGAGCAAAGAGCAGCAGGTCGG + Intergenic
1023608731 7:41953714-41953736 CAGAACTAACAGCAGGTGGATGG + Intergenic
1024218298 7:47266518-47266540 CAGGGCAAAGGGCAGAAAGAGGG + Intergenic
1024242726 7:47447995-47448017 CAGAGAAGACAGCAGGAGGCTGG + Intronic
1024350712 7:48359877-48359899 CAGATCAAATACCAGGAGCAAGG + Intronic
1024363974 7:48500330-48500352 CTGAGCAAAAAGCAGCAGGTAGG - Intronic
1024610465 7:51059750-51059772 TAGTGCAAACAGCAGGATGAGGG - Intronic
1024871684 7:53970640-53970662 TAGAACAAAAAGCAGGAGGAAGG - Intergenic
1025288171 7:57685618-57685640 GAGACCAAGGAGCAGGAGCATGG + Intergenic
1025770489 7:64500782-64500804 CAAAGCCAAAAACAGGAGGAAGG - Intergenic
1026159064 7:67852834-67852856 GAGAGAAAGGAGGAGGAGGAGGG + Intergenic
1026206234 7:68260278-68260300 GAGACAAAAGAGAAGGAGGAAGG - Intergenic
1026379010 7:69780526-69780548 TAGGGCAAAGAGGAGGAGGGCGG + Intronic
1026474908 7:70726900-70726922 GAGAGGAAAGAGAATGAGGAAGG - Intronic
1027555935 7:79664882-79664904 CAGAGCACAGGGCTGGAGTATGG - Intergenic
1027838921 7:83281837-83281859 CAGAGGAAAGATCTGGAGAAAGG - Intergenic
1027965435 7:84999675-84999697 CAGAGGGCAGAGCATGAGGAGGG - Exonic
1029275061 7:99399062-99399084 AAGAGCCAAGTGCTGGAGGAGGG + Intronic
1029308780 7:99641862-99641884 CAGAGGAAAGAGTAGAAGCAGGG - Intergenic
1030153529 7:106429050-106429072 CAGGGCAAGAAGCAGGAGTATGG - Intergenic
1030379001 7:108789993-108790015 GAGAGTGAAGGGCAGGAGGAGGG - Intergenic
1030693000 7:112553884-112553906 TACAGCAGAGGGCAGGAGGATGG + Intergenic
1030751800 7:113238766-113238788 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1030845231 7:114400972-114400994 AAGAGGAAATAGCAGGAGTAAGG + Intronic
1031399639 7:121315869-121315891 CGGAGCAAAGAGCAGAAGGACGG - Intergenic
1031728221 7:125264117-125264139 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
1031777029 7:125918022-125918044 TGGAGCAAAGAGCAGGAGGAAGG - Intergenic
1031878845 7:127173383-127173405 CAGAGCAAAGGTCATGGGGAAGG + Intronic
1031923508 7:127618174-127618196 CAGAGGAGAGAGGAGGAGGGAGG + Intergenic
1032301337 7:130690099-130690121 AGGAGCAAAGAGCAGGAGGAAGG + Intergenic
1032653412 7:133903068-133903090 CAGGGCAAAGGCCAGGAGGCAGG + Intronic
1032869959 7:135974540-135974562 CAAAAAAAAGAGGAGGAGGAGGG + Intronic
1033004596 7:137548004-137548026 AAGAGCAAAGAGAATGAAGAAGG + Intronic
1033046487 7:137967098-137967120 CAGGGCAAAGAGGAGTGGGAAGG - Intronic
1033134394 7:138772956-138772978 GAGAGCCAAGGGGAGGAGGAGGG + Intronic
1033465324 7:141583971-141583993 TGGAGCAAAGAGCAGGAGGACGG + Intronic
1033651744 7:143349137-143349159 CATAGAAAAGACCAAGAGGACGG + Intronic
1033669623 7:143478585-143478607 CAGAGCATAAAGAATGAGGAAGG - Exonic
1033679675 7:143582169-143582191 CAGAGAAATGAACATGAGGAGGG - Intergenic
1033692160 7:143747274-143747296 CAGAGAAATGAACATGAGGAGGG + Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034468510 7:151243682-151243704 CAGTGCCAAGAGGAGGAAGATGG - Exonic
1035287724 7:157816860-157816882 AAGAGAAAAGAGGAGGAGAAAGG - Intronic
1035723748 8:1812393-1812415 CAGACCAAAGATGAGGAGGGCGG + Intergenic
1035913217 8:3592605-3592627 CAAAGCTGTGAGCAGGAGGAAGG + Intronic
1036039647 8:5060994-5061016 CTGAGCAAGGAGGAAGAGGAAGG - Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036648433 8:10626225-10626247 CAGAGTGAATAGCGGGAGGATGG + Intronic
1036665995 8:10739558-10739580 TAGCACAAAGATCAGGAGGAGGG + Intronic
1037548689 8:19948782-19948804 CACAGCACAGAGCTGGAGAATGG - Intronic
1037611541 8:20480390-20480412 CAGATCAAAGGGAAGGAGGATGG + Intergenic
1037780111 8:21862234-21862256 CTGAGCAAAGTCCAGCAGGAGGG - Intergenic
1037935679 8:22913581-22913603 CTGAGGGAAGAGGAGGAGGAAGG - Intronic
1038050674 8:23807576-23807598 GAAAGCAAAGAGAAGCAGGAAGG + Intergenic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038662168 8:29506716-29506738 CAGAACAAAGATGAAGAGGAGGG - Intergenic
1039370726 8:36981575-36981597 CAGAGGAGAGGACAGGAGGAAGG - Intergenic
1040023851 8:42763939-42763961 CAGAGCAAAGTCTGGGAGGAAGG + Intronic
1041085301 8:54251215-54251237 CATAGCAAAAAGCAGAAGGGTGG - Intergenic
1042419123 8:68564641-68564663 CAGATCACAAACCAGGAGGAAGG - Intronic
1042488291 8:69370690-69370712 AAGAGGAAAGCGCTGGAGGAGGG - Intergenic
1043185030 8:77137810-77137832 CAAGGCAAAGAGCAGCATGAAGG - Intergenic
1044148786 8:88747350-88747372 TGGAGCAAAGAGCAGGAGGATGG + Intergenic
1044416776 8:91948477-91948499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1045077929 8:98590550-98590572 AGGAGCAAAAAGCAGGAGGACGG + Intronic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045242183 8:100412152-100412174 GAGCTCAAAGAGCAGGAAGAGGG - Intergenic
1045644484 8:104286391-104286413 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1045680337 8:104652969-104652991 CTGAGCAAACAGCAAGAGGGCGG - Intronic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1045791867 8:105993031-105993053 GAGAGGAGAAAGCAGGAGGAAGG - Intergenic
1045987405 8:108264574-108264596 CATGGCTGAGAGCAGGAGGAAGG - Intronic
1046035841 8:108840369-108840391 CAGAACAAAAAGGTGGAGGAAGG - Intergenic
1046299542 8:112269222-112269244 CAGAGGACAGATCAGGAAGATGG - Intronic
1046520676 8:115321060-115321082 AAGAGAATAGAGCAGGAAGAAGG - Intergenic
1047073016 8:121368490-121368512 AAGAGCAAATATCAGGAAGATGG - Intergenic
1047428305 8:124766859-124766881 GAGAGCAAAGAGGAGGATGCTGG + Intergenic
1047829823 8:128617106-128617128 GGGAGCAAAGAGCAGGAGGAAGG + Intergenic
1048003466 8:130399121-130399143 CACATCTAACAGCAGGAGGAAGG - Intronic
1048115531 8:131517644-131517666 GAGAGGAAAGAACAGGAGAAAGG - Intergenic
1048168741 8:132085479-132085501 TGGAGCAAAGAACAGGAGGACGG + Exonic
1048194533 8:132321506-132321528 GAGAGCAAACAGAAGCAGGAGGG - Intronic
1048220766 8:132539478-132539500 CAGAACAAAGACCACGAGAAAGG + Intergenic
1048585748 8:135772508-135772530 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
1048630861 8:136240829-136240851 CAGAGCAAAGATCAAGAAGAAGG - Intergenic
1049000447 8:139822601-139822623 GAGAGCCAAGAGCCGTAGGATGG + Intronic
1049278185 8:141730384-141730406 GAGAGGAAGGAGGAGGAGGAGGG - Intergenic
1049298365 8:141855781-141855803 AGGAGCCAACAGCAGGAGGAGGG + Intergenic
1049343945 8:142128579-142128601 CTGGGAAAAGAGCAGGAGGGTGG + Intergenic
1049667601 8:143853433-143853455 CAGAGCAGCGACCTGGAGGAGGG + Intergenic
1049804110 8:144531183-144531205 CAGGGCAGAGAGCAGCAGGTGGG + Intronic
1050432806 9:5578994-5579016 CAGAGCAGAGGAGAGGAGGATGG + Intergenic
1050637364 9:7626466-7626488 CAAAGCAAAGAGCCAGAGAAGGG + Intergenic
1050747374 9:8892036-8892058 CAGAGAAAAGAAAAGCAGGAAGG - Intronic
1051097463 9:13483209-13483231 CATGGAAAAGAGGAGGAGGAAGG - Intergenic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1051749964 9:20330538-20330560 CAGTTCAAAGAGAAAGAGGAGGG + Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1053278556 9:36801476-36801498 AAGAGCAAAGAGAAGATGGAAGG + Intergenic
1053368844 9:37543565-37543587 CAGAGAAAAGGGCAGAAGCAAGG + Intronic
1053402750 9:37841145-37841167 CAGATCCAGGGGCAGGAGGAAGG + Intronic
1053504167 9:38627073-38627095 AAGAGCAAAGAGCCGGAGAGGGG + Intergenic
1053674680 9:40412149-40412171 AGGAGCAAAGAGCAGAAGGTTGG - Intergenic
1053924473 9:43038504-43038526 AGGAGCAAAGAGCAGAAGGTTGG - Intergenic
1054385784 9:64552216-64552238 AGGAGCAAAGAGCAGAAGGTTGG - Intergenic
1054509940 9:65964145-65964167 AGGAGCAAAGAGCAGAAGGTTGG + Intergenic
1054745771 9:68852616-68852638 CAGGGCACAGAGCAGGGTGAAGG + Intronic
1054890619 9:70247010-70247032 CAGGGCATAGAGCAGGTTGAGGG + Intergenic
1055343447 9:75309351-75309373 GAGAGCAAAGAAAAGCAGGATGG - Intergenic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1055720942 9:79174338-79174360 CAGAGCAAAGAGCTTAAGAATGG + Intergenic
1055738879 9:79363969-79363991 CAGAAGAAAGAGTAGGAAGAAGG - Intergenic
1055901186 9:81239879-81239901 TAGACCAAAGAGCAGGAGATTGG - Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056437571 9:86588514-86588536 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1056522096 9:87411198-87411220 CGGAGCAAAAAGCAGGAGGACGG - Intergenic
1056559644 9:87718973-87718995 CAGGTCACAGAGCAGGTGGAGGG - Intergenic
1056965185 9:91159452-91159474 GAGAGGAAAGAGAAAGAGGAGGG + Intergenic
1057004968 9:91549040-91549062 TGGAGCCAAGAGCAGGAGGAAGG - Intergenic
1057152208 9:92806521-92806543 AAGAGCAAAGAGCCGGAGAGGGG - Intergenic
1057168381 9:92945886-92945908 CAGAGCAATGAGCGGGAGCTGGG + Intergenic
1057187084 9:93062995-93063017 CAGTGCCAAGAGTAGGAGGCTGG - Intronic
1057254083 9:93529327-93529349 CAGTGCAGAGAGCAGAAGGGAGG - Intronic
1057317233 9:93977470-93977492 CAGGGCGCAGAGCAGAAGGAAGG - Intergenic
1057377691 9:94540349-94540371 TGGAGCAAAGAGTAGGAGGACGG - Intergenic
1057518146 9:95738665-95738687 TAGATCAAAGGGCAGGAGGAAGG - Intergenic
1057605748 9:96496776-96496798 CAGAGGAAGGAGCTGGAGGAAGG - Intronic
1058181951 9:101809259-101809281 TAGAACAAAGAGCAGGAGGAAGG + Intergenic
1058552404 9:106128948-106128970 CAGAGCTACGAGATGGAGGAGGG + Intergenic
1058637324 9:107049285-107049307 CAGTGGACAGTGCAGGAGGAGGG - Intergenic
1058740212 9:107935329-107935351 GACAGCAGGGAGCAGGAGGATGG + Intergenic
1059208475 9:112487460-112487482 CAGACCCAAGAGCAGGAGCGGGG - Intronic
1059373330 9:113861649-113861671 CAGAGAACTCAGCAGGAGGATGG - Intergenic
1059574285 9:115473684-115473706 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1059588813 9:115635251-115635273 CAGAGGAAGGAGCAGTAGGTGGG - Intergenic
1060438634 9:123617714-123617736 CAGAGCAAAGGTCAGGAGACAGG + Intronic
1060723685 9:125994203-125994225 CAGAGCTAAGAGCAGGATGGAGG - Intergenic
1060741729 9:126103201-126103223 CAGAGGAGAGAGCAGGTGGAAGG - Intergenic
1060939816 9:127536785-127536807 CAGAGCTAGGACCAGGAGGGTGG - Intronic
1060975879 9:127764682-127764704 AACAACAAAGAGCAGGAGGGAGG - Intronic
1061255876 9:129454032-129454054 CAGAGGAAAGGGCAGGTGGTTGG + Intergenic
1061899681 9:133666509-133666531 GAGAGGAAGGAGGAGGAGGAGGG - Intronic
1061992757 9:134168837-134168859 CTGAAGACAGAGCAGGAGGAAGG + Intergenic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1062497923 9:136840361-136840383 AAGAGCAAGGACAAGGAGGAGGG + Exonic
1185545400 X:939789-939811 AAGAGAAAAGAGGAGGAGGGGGG - Intergenic
1185858882 X:3559656-3559678 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1185961015 X:4545799-4545821 GGGAGCAAAGAGCAGGAGGACGG + Intergenic
1186161234 X:6779103-6779125 GAAAGCAAAGAGCAGGGGGAGGG + Intergenic
1186611308 X:11140460-11140482 GAAAGCAAAGATCAGTAGGAAGG - Intronic
1186940605 X:14503234-14503256 CAGAGGACAGAGCAGTAGGGTGG + Intergenic
1188542963 X:31269984-31270006 GAGAGGAAAGGACAGGAGGAAGG + Intronic
1189374816 X:40458745-40458767 AGGAGCAAAGAGCAGGGGAAAGG + Intergenic
1189933811 X:46043513-46043535 TAGAGCAAAAAGGAAGAGGAAGG + Intergenic
1190144154 X:47875147-47875169 CAGAGCAAGGAGGAGCAGGAGGG + Intronic
1190407014 X:50098361-50098383 CAGAGGTAAGAACAGGAGGCTGG - Exonic
1190681467 X:52830351-52830373 TGGAGGAAAGAGCAGGGGGAGGG - Intergenic
1190700241 X:52982648-52982670 CAGAGAAAAGATCTAGAGGACGG - Intronic
1190942975 X:55061386-55061408 GAGAGTAGAGAGCAGGAGGAGGG - Intergenic
1191223772 X:58017899-58017921 CAGAGCATAGAGAGGGAGCATGG + Intergenic
1191840368 X:65509461-65509483 CAGAACAAGGAGTAGAAGGAAGG - Intergenic
1192169014 X:68843057-68843079 CAGAGGAAAGAGGAAGAAGAAGG + Intergenic
1192191038 X:68991266-68991288 AAGAACAAAGAGATGGAGGAAGG - Intergenic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1192960561 X:76126613-76126635 GAGAGCAAAGAGAAGCAGGGTGG + Intergenic
1193039144 X:76986564-76986586 GAGAGAAAAGAGGAAGAGGAGGG - Intergenic
1193941161 X:87682181-87682203 TGGAGCAGAGAGCAGGAGGATGG - Intergenic
1194044843 X:88989787-88989809 AAGAGCAAATAGTGGGAGGAAGG - Intergenic
1196055976 X:111355698-111355720 CAGAGCCAAGAGAAGGGGAAAGG + Intronic
1196310097 X:114153803-114153825 CAGAGAAAAGAGAGGGAGAATGG + Intergenic
1196388469 X:115185636-115185658 CAGAGAAAAGATGGGGAGGAGGG - Intronic
1196496509 X:116329774-116329796 CACAGCAATGAGAAGGAGCATGG + Intergenic
1196528473 X:116755115-116755137 CAAAGTAAAGAGTATGAGGAAGG + Intergenic
1196533833 X:116817702-116817724 TGGAGCAAAGAGCAGGAGGACGG + Intergenic
1196894668 X:120323153-120323175 TAGAACAAATAGCTGGAGGAAGG - Intergenic
1197064614 X:122222506-122222528 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1197718935 X:129731565-129731587 CAGAGTAAAGAGAGGAAGGAAGG + Intergenic
1198162316 X:134019820-134019842 GAGAGCACAGAGTAGGAGGTTGG - Intergenic
1198310650 X:135424174-135424196 CACAGGGAAGATCAGGAGGACGG + Intergenic
1199576160 X:149316084-149316106 TGGAGCAAAGAGCAGGAGGATGG - Intergenic
1199587844 X:149435230-149435252 AAGATCAAAGAGTAGGAGGTTGG - Intergenic
1199781195 X:151061576-151061598 GATATCAAAGAGCAAGAGGAGGG + Intergenic
1200089732 X:153628818-153628840 CAGGGCCAAGAGCCGGGGGAGGG + Intergenic
1200137806 X:153883425-153883447 CAGAGGAGAGAGCAGGGGGGCGG + Intronic
1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG + Intergenic
1201078056 Y:10201069-10201091 CGCAGCCAAGAGCAGGAGGTGGG - Intergenic
1201304631 Y:12540247-12540269 GAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1201690072 Y:16753327-16753349 CAGCCCAAAGAGCAGAAGCAGGG - Intergenic
1202273667 Y:23094715-23094737 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202292360 Y:23325966-23325988 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic
1202371177 Y:24197080-24197102 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1202376150 Y:24239389-24239411 CAATGGAAAGAGCAGGAGAAGGG - Intergenic
1202426663 Y:24728460-24728482 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202444126 Y:24941626-24941648 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic
1202494630 Y:25430729-25430751 CAATGGAAAGAGCAGGAGAAGGG + Intergenic
1202499607 Y:25473037-25473059 CAATGGAAAGAGCAGGAGAAGGG + Intergenic