ID: 1119320699

View in Genome Browser
Species Human (GRCh38)
Location 14:73728511-73728533
Sequence CCAGAGCTGAGCCGCAGCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 156}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119320699_1119320707 14 Left 1119320699 14:73728511-73728533 CCATCGCTGCGGCTCAGCTCTGG 0: 1
1: 0
2: 2
3: 18
4: 156
Right 1119320707 14:73728548-73728570 AATACAGTCCTCACCATCCCAGG 0: 1
1: 0
2: 0
3: 14
4: 155
1119320699_1119320712 27 Left 1119320699 14:73728511-73728533 CCATCGCTGCGGCTCAGCTCTGG 0: 1
1: 0
2: 2
3: 18
4: 156
Right 1119320712 14:73728561-73728583 CCATCCCAGGCTAGCTGCTGGGG 0: 1
1: 1
2: 0
3: 25
4: 312
1119320699_1119320709 25 Left 1119320699 14:73728511-73728533 CCATCGCTGCGGCTCAGCTCTGG 0: 1
1: 0
2: 2
3: 18
4: 156
Right 1119320709 14:73728559-73728581 CACCATCCCAGGCTAGCTGCTGG 0: 1
1: 0
2: 1
3: 16
4: 223
1119320699_1119320710 26 Left 1119320699 14:73728511-73728533 CCATCGCTGCGGCTCAGCTCTGG 0: 1
1: 0
2: 2
3: 18
4: 156
Right 1119320710 14:73728560-73728582 ACCATCCCAGGCTAGCTGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119320699 Original CRISPR CCAGAGCTGAGCCGCAGCGA TGG (reversed) Intronic
900099769 1:956812-956834 CCTGAGGTGAGCAGCAGCGAGGG - Intronic
900162552 1:1231348-1231370 CCAGAGCTGAAGCCCAGGGATGG - Intronic
900380702 1:2382466-2382488 CCAGAGCTGTGCACCAGCGCCGG + Intronic
903229821 1:21914940-21914962 CCAGAGCCCAGCCACAGCCACGG + Intronic
906074092 1:43039260-43039282 CCCGAGCTGAGCCCCAGAGCAGG - Intergenic
906533915 1:46540867-46540889 GCAAAGCTGAGCCCCAGTGACGG - Intergenic
907309940 1:53533512-53533534 CCAGAGCTGAGCCACAGGCTGGG + Intronic
907755898 1:57310467-57310489 CCAGAGCTGGGCCCTAGAGATGG + Intronic
912430189 1:109624726-109624748 TCAGAGCTGAGCAGCAGCTGCGG + Intronic
914915667 1:151817685-151817707 TGGGAGCTGAGCCCCAGCGAGGG - Intronic
916172090 1:162009282-162009304 CCAGAGCTGGGCCGCAGGTGTGG - Intronic
919754149 1:201056282-201056304 CCAGAGCTCAGCCTCAGCTGAGG + Intronic
923765606 1:236890055-236890077 CCAGATCAGAGCAGCAGGGAGGG + Intronic
1063346797 10:5319195-5319217 CAATAGCTGAGCCGCTGCGCTGG + Intergenic
1063698412 10:8360273-8360295 CCAGTGGTGAGCTGCAGAGATGG + Intergenic
1067084422 10:43230324-43230346 GCTGATCCGAGCCGCAGCGAGGG + Intronic
1067992223 10:51227688-51227710 CCAGAGTTCAGCAACAGCGAAGG + Intronic
1069858278 10:71453751-71453773 CCAGAGCTGTCCCACAGCGAGGG + Intronic
1070982766 10:80662994-80663016 ACAGAGCTGTGCCGCAGAGGTGG + Intergenic
1071661233 10:87504968-87504990 CGAGAGCAGCGCCGCAGCCAGGG - Exonic
1073119760 10:101114390-101114412 CCAGAGGTCAGCTGCAGAGAAGG - Intronic
1074308851 10:112303775-112303797 CCAGAGCTGAGCCCCCACGCAGG + Exonic
1075402672 10:122172386-122172408 CCAGATCTGAGCCCCAGGAAGGG - Intronic
1077557429 11:3232330-3232352 CGAGAGCTGAGCGGAAGAGAAGG - Exonic
1083289842 11:61683663-61683685 CCAGAGCTGAGTGGCAGGCAGGG + Intronic
1083651578 11:64207599-64207621 CGGGAGCTGAGCAGCAGGGATGG - Intronic
1083782325 11:64924933-64924955 CCCGAGCGGAACCGCTGCGAAGG + Exonic
1084953801 11:72680834-72680856 CCAGAGCTGGGCGCCAGAGAGGG - Intergenic
1085029854 11:73264490-73264512 CCAGAGCAAAGCGGCAGGGAGGG - Intronic
1087021977 11:93612071-93612093 CCAGACCTCAGCTGCAGCGCTGG + Intergenic
1087117967 11:94544396-94544418 CCAGCGGCGAGCGGCAGCGACGG + Exonic
1089401841 11:118168842-118168864 GCAGAGCAGAGCCACAGGGAGGG + Intronic
1089614438 11:119687316-119687338 CCAGAGCAGGGCCTCAGGGATGG - Intronic
1089737403 11:120559264-120559286 CAAGAGATTAGCCGAAGCGAGGG - Intronic
1090644075 11:128753259-128753281 CCAGAGCTGAGCCCCACATAGGG + Intronic
1091753697 12:3038363-3038385 CAAGAGCAGAGCCGCAGCACAGG + Intronic
1091786219 12:3244751-3244773 CCAGAGCTCAGCAGTAGAGAAGG + Intronic
1102391245 12:112550511-112550533 CCGGAGCAGAGCCGCAGATAAGG + Intergenic
1104107634 12:125679306-125679328 CCACAGCTGATCCCCAGAGAAGG + Intergenic
1104664603 12:130638788-130638810 CCAGGGGTGAGCAGCAGGGAGGG + Intronic
1104726315 12:131077635-131077657 CCACAGCTGAGCAGCAGCTGAGG - Intronic
1106544183 13:30715995-30716017 CCAGAGCTGAGCTGCTGCAAGGG + Intronic
1110433923 13:75458337-75458359 GCAGAGCTGTGCAGCAGAGAAGG - Intronic
1112370000 13:98785751-98785773 CCAGGGATGAACCGCAGCCAAGG + Intergenic
1113902295 13:113803959-113803981 CCAGGCCAGAGCCGCTGCGAGGG - Intronic
1117913022 14:60652451-60652473 CCCGAGCCGCGCTGCAGCGAGGG - Intronic
1119320699 14:73728511-73728533 CCAGAGCTGAGCCGCAGCGATGG - Intronic
1119737935 14:76995742-76995764 CCAGCTCTGAGCCCCAGCCATGG + Intergenic
1121439138 14:93937808-93937830 CCAGAGGTGAGCCGCTGGGCGGG - Exonic
1121448331 14:93992521-93992543 CCAGGGCTGAGGGGCAGCCAGGG - Intergenic
1121520425 14:94582496-94582518 CCAGAGCTGAGAGACAGGGAGGG + Intronic
1122674810 14:103403048-103403070 TCAGAGCTGAGGGGCAGGGATGG - Intronic
1127654891 15:61046532-61046554 CCAGAGGCGAGCCGCAGGAAGGG + Intronic
1129868162 15:78924423-78924445 CCAGGGCAGAGCCTCAGGGAGGG + Intronic
1130748103 15:86677653-86677675 TCAGAGCTGTGCCTCAGCAATGG + Intronic
1132223749 15:100124880-100124902 CCAGAGCAGAGAAGCAGCAAAGG + Intronic
1132380278 15:101361481-101361503 CCAGGTCTGAGCTGCAGCCATGG + Intronic
1132657464 16:1047223-1047245 CCAGAGCTGGGCAGGAGAGATGG + Intergenic
1133203424 16:4218486-4218508 CCAGGGCTGAGCCACAGAGATGG + Intronic
1134066244 16:11230294-11230316 CCAGAGCAGAGGCTCAGGGAGGG - Intergenic
1135306387 16:21370942-21370964 GCAGAGCTGAGTCACTGCGATGG - Intergenic
1136303132 16:29350086-29350108 GCAGAGCTGAGTCACTGCGATGG - Intergenic
1141600987 16:85126255-85126277 CCACAGCTGAGCCCCAGCTTCGG - Intergenic
1141879152 16:86846477-86846499 CCACAGGTGAGCGGGAGCGAAGG + Intergenic
1142236779 16:88926160-88926182 GCAGAGCAGAGCCGCAGCCGGGG + Intronic
1142350207 16:89576186-89576208 CCCGAGCTGAGCCCCAGCTCCGG - Intronic
1142672171 17:1492308-1492330 CAAGAGCTGAGCAGCGGGGAGGG - Intronic
1143400261 17:6638728-6638750 GAAGAGCTGAGCCACAGCGGGGG - Intronic
1143474719 17:7196083-7196105 CCAGGCCTGAGGCGCAGCCAGGG - Intronic
1144930941 17:18858277-18858299 CCAGTGGCGAGCGGCAGCGAGGG + Intronic
1146055050 17:29576794-29576816 ACAGAGCTGGGCCTCAGCGAAGG + Intronic
1147121665 17:38338716-38338738 CCTGAGCTGAGCCAAAGCCAGGG - Intronic
1148913124 17:50953981-50954003 CCTGAGCTGAGTGGCAGGGAGGG - Intergenic
1149914928 17:60600227-60600249 CGAGAGCTGGGCCGGAGCGCCGG - Exonic
1150209319 17:63433597-63433619 CCAGAGCTGAGCCGCAAGGGGGG + Exonic
1150228033 17:63534370-63534392 CCAGTGCTGTGCAGCAGGGAGGG - Intronic
1151583253 17:74992139-74992161 CCAGAGCAGAGACTCAGCAAAGG - Intronic
1151894371 17:76970042-76970064 CCAGTGCTGTGCCCCAGCCAGGG - Intergenic
1152202189 17:78953667-78953689 CCAGAGCTGAGCTTCAGAGAGGG + Intergenic
1152390433 17:80001012-80001034 CCAGAGCTGAGGGGCAGCCAGGG + Intronic
1152424637 17:80212295-80212317 GCAGAGCTCAGCCGCAGACACGG + Intronic
1156610811 18:38721881-38721903 CCAGAGCTCATCTGCAGAGAGGG + Intergenic
1159003591 18:62993530-62993552 CCAGGGCACAGCCGCAGGGATGG + Intergenic
1160280127 18:77481944-77481966 ACAGAGCTGAGTAGCAGCAATGG - Intergenic
1160807587 19:999324-999346 CCAGAGCTGAGTTGAAGAGATGG + Intergenic
1161405729 19:4090222-4090244 CCTGAGCTGACCCGCATCGCCGG - Intergenic
1161428928 19:4219649-4219671 CCACAGCAGAGCAGCAGCTACGG + Exonic
1163262570 19:16199959-16199981 ACACAGCTGAGCAGCAGGGATGG - Intronic
1164706757 19:30325568-30325590 CCAGACTTGAGCCTCAGGGAAGG - Intronic
1168154093 19:54463630-54463652 CCAGAGCTAGGCCGGAGCGCGGG - Exonic
925327585 2:3035470-3035492 GCAGAGCTGAGTCACCGCGACGG - Intergenic
926227442 2:10978491-10978513 CCAGAGGTGGGCAGCAGCGATGG - Intergenic
935413451 2:102789565-102789587 CCAGAGCTAAGCAGCTGGGATGG - Intronic
944321110 2:198343513-198343535 TCAGAGGTGAGCAGCAGAGAAGG - Intronic
948621591 2:239238591-239238613 CCAGTGGTGAGCAGCAGCGGTGG + Intronic
948707145 2:239801869-239801891 CCGCAGGTGAGCTGCAGCGAAGG + Exonic
948827058 2:240577959-240577981 CCAGAGCCGAGACGCAGTCATGG - Exonic
948982329 2:241500745-241500767 CCAGTGCTGAGCCGCCGCCCAGG + Exonic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1171961285 20:31496867-31496889 CCAGCCCTGAGCCTCAGCCAGGG - Intergenic
1172409302 20:34709961-34709983 ACAGAACTGAGCCGAAGCAAGGG + Intronic
1172444347 20:34985247-34985269 CCTGAGCTGGGCAGCAGCCAGGG - Intronic
1173498233 20:43534220-43534242 GCAGAGCTGAGCCCCACAGAGGG - Intronic
1176182178 20:63755127-63755149 CCAGGGCAGAGCCGCAGCTGCGG + Intronic
1179540854 21:42082580-42082602 CCAGTGCTGGGCCCCAGAGAAGG - Intronic
1179982747 21:44905155-44905177 CCAGAGTAGAGGCTCAGCGAAGG + Intronic
1181585257 22:23849535-23849557 CAAGAGCTGAGGGGCAGGGAGGG + Intergenic
1182441790 22:30369032-30369054 ACAGAGCTGAGACCCAGAGAGGG - Intronic
1184286543 22:43475001-43475023 CCAGAGCTGAGGCTGAGCGCAGG + Intronic
950106382 3:10391658-10391680 CCAGAGCTGAGCAATAGCCAGGG + Intronic
951110282 3:18795217-18795239 CCAAAGCTGAGCCCCAGCAATGG - Intergenic
953891896 3:46756896-46756918 CCAGGGCGGAGCCGCCGCGAGGG - Intronic
954216131 3:49125496-49125518 GCAGAGCTGAGCCAGAGCCAGGG + Intronic
956708337 3:72018616-72018638 TCAGAACTGAGCCACAGAGAAGG + Intergenic
958894857 3:99818088-99818110 CCAGGGCTGAGGCGCACGGAAGG - Intronic
960393086 3:117103419-117103441 CCAGTGCTGAGCCGCTGCAGAGG - Intronic
968648736 4:1752152-1752174 CCTGAGCTGGGCCCCAGCGTGGG + Intergenic
969590605 4:8119899-8119921 CCAGATCTGAGCGGAGGCGAAGG - Intronic
972678157 4:41280107-41280129 CCAGAGCTGTGCCGCCTGGAAGG - Intergenic
975643197 4:76521030-76521052 CCTGAGCTTAGCAGCAGCCACGG - Intronic
976184336 4:82429923-82429945 CCAGTGCGGAGCCGCTGCGGCGG + Exonic
976473395 4:85455321-85455343 GCAGAGCAGAGCAGCAGAGAGGG + Intergenic
977323306 4:95547195-95547217 CCAGAGCAGAACCTCAGGGATGG + Intronic
978398826 4:108310262-108310284 GCAGAGTGGAGCAGCAGCGAAGG + Intergenic
983781409 4:171674541-171674563 GCAGAACTGAGCAGCAGAGAAGG + Intergenic
988541162 5:32111449-32111471 CAAGTGCTGAGTGGCAGCGAGGG - Intergenic
990829633 5:59941922-59941944 CCAGAGCTTAGCCTTAGCAATGG + Intronic
992104138 5:73436604-73436626 CCAGAGCCCAGCCCCAGCGCGGG - Intergenic
1001529998 5:172454702-172454724 CCGGTGCTGAGCCGCCGCGCCGG + Intergenic
1002806751 6:583859-583881 CCAGTGCTGAGCTGCAGGGAGGG + Intronic
1002947170 6:1773616-1773638 CCTGTGCTGAGCAGCATCGATGG + Intronic
1006002705 6:30978119-30978141 CATGAGCTGAGCCACAGCCATGG + Intergenic
1006384114 6:33719551-33719573 CCAGAGAGGAGCGGCAGCGAGGG - Intergenic
1006576647 6:35051285-35051307 GCAGAGCGGAGAAGCAGCGAGGG + Intronic
1011615571 6:89194934-89194956 ACAGAGCTGAGCAACAGCAAGGG + Intronic
1014841787 6:126228118-126228140 CCAGAGCTGGGCCTCACAGAGGG - Intergenic
1023865559 7:44236597-44236619 GCAGATTTGAGCTGCAGCGAGGG - Intronic
1023909323 7:44542185-44542207 CCAAAGCTGAGCTGCAGATAAGG + Intergenic
1024237687 7:47410226-47410248 GCAGTGCTGTGCTGCAGCGATGG - Intronic
1024930687 7:54664490-54664512 CCAGAGCTGAGCTGCAGCGGTGG - Intergenic
1026416213 7:70183497-70183519 CCAGGGCTGAGCTGCAGAGAAGG - Intronic
1026792955 7:73346603-73346625 CCAGAGCTGAGCTGCTCTGAGGG + Intronic
1027402773 7:77825429-77825451 CCAGCGCTGAGCCTCAGCAGAGG + Intronic
1029482870 7:100823607-100823629 CCAGGGCTCAGCCACAGCCAAGG - Intronic
1029664613 7:101987059-101987081 CCTGAGCTGAGGCACAGGGAGGG - Intronic
1030150384 7:106398603-106398625 CCATGGCTGAGCCCCAGCAAAGG + Intergenic
1032078673 7:128848089-128848111 CCAGAGCTCAGCCGCAGCACAGG - Intronic
1034621406 7:152460069-152460091 CTGCAGCTGAGCCGCAGGGATGG + Intergenic
1035473880 7:159128859-159128881 ACTGAGCTCAGCCGCAGGGAGGG - Intronic
1035738215 8:1904739-1904761 TCAGAGCTGGGCAGCAGCGTAGG + Intronic
1039216809 8:35281085-35281107 CGAGATCTGAGGCACAGCGAAGG - Intronic
1042896923 8:73680372-73680394 TGAGAGCTGAACTGCAGCGATGG - Intronic
1047782835 8:128123755-128123777 CCAGAGCTGAGGCCCTGCGGTGG + Intergenic
1048862925 8:138737108-138737130 GCAGAGCTGTGCCCCAGGGAAGG + Intronic
1049219922 8:141424488-141424510 CCCCAGCTGAGCCGCAGGGATGG - Intronic
1049310682 8:141932086-141932108 CCAGAGCTGACCGGGAGCCATGG - Intergenic
1049377038 8:142294193-142294215 CCAGAGGTGAGACGCAGCAAAGG + Intronic
1049873401 8:144999573-144999595 CAGGAGCTGAGCCCCAGGGAGGG + Intergenic
1052608737 9:30740694-30740716 CCAGAGCTGAGCCCCAACTTGGG - Intergenic
1052781021 9:32782701-32782723 CCAGAGCTGAGCGGCGTCGTAGG + Intergenic
1053487376 9:38470074-38470096 CCAGAACTGAGGCCCAGGGAGGG + Intergenic
1054750107 9:68897072-68897094 GCAGAGCTGAGCCTCAGTGCTGG + Intronic
1055561252 9:77523705-77523727 GCAGAGCAGAGGGGCAGCGAAGG + Intronic
1059613684 9:115925785-115925807 CCAGAGCAGAGTGGCAGGGATGG - Intergenic
1059651562 9:116320348-116320370 CCAGAGCTGAGCCCCAAGGCTGG + Intronic
1059769606 9:117413915-117413937 CCAGAACTGAGGCTCAGAGAAGG + Intronic
1060205250 9:121678940-121678962 CCAGGGCTGAGCCACGGAGATGG - Intronic
1061617134 9:131787675-131787697 CCAGGGATGAGCTGCAGGGAGGG - Intergenic
1062021146 9:134319963-134319985 CTTGAGCTGAGACGCAGGGAGGG - Intronic
1062250734 9:135592378-135592400 CCAGGGCTGACCCTGAGCGATGG + Intergenic
1185612710 X:1402077-1402099 CCAGGGGTGAGCGGCAGCGATGG + Intergenic
1187917588 X:24169838-24169860 CCTGGGCTGAGCCGCAGTAAGGG + Intronic
1189231144 X:39453430-39453452 CAGGAGCTGAGCCCCAGGGATGG + Intergenic
1189292342 X:39895255-39895277 CCAGACCTGAGCCTCAGCGAGGG - Intergenic
1190693760 X:52934675-52934697 CCAGTGCTGAGTTTCAGCGAGGG + Intronic
1194279549 X:91932232-91932254 CCAAAGCTGAGCCACAGCTGTGG + Intronic
1199432457 X:147776709-147776731 GCAGAGCAGAGCTGCAGAGAAGG - Intergenic