ID: 1119322369

View in Genome Browser
Species Human (GRCh38)
Location 14:73739567-73739589
Sequence TCCCCTTGGTTGCACTGTAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 226}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119322368_1119322369 -10 Left 1119322368 14:73739554-73739576 CCAGGATGCGGGCTCCCCTTGGT 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1119322369 14:73739567-73739589 TCCCCTTGGTTGCACTGTAGAGG 0: 1
1: 0
2: 0
3: 10
4: 226
1119322359_1119322369 25 Left 1119322359 14:73739519-73739541 CCTCAGGGTGGTTATAGTAAGTC 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1119322369 14:73739567-73739589 TCCCCTTGGTTGCACTGTAGAGG 0: 1
1: 0
2: 0
3: 10
4: 226
1119322366_1119322369 -5 Left 1119322366 14:73739549-73739571 CCACTCCAGGATGCGGGCTCCCC 0: 1
1: 0
2: 1
3: 16
4: 181
Right 1119322369 14:73739567-73739589 TCCCCTTGGTTGCACTGTAGAGG 0: 1
1: 0
2: 0
3: 10
4: 226
1119322365_1119322369 -4 Left 1119322365 14:73739548-73739570 CCCACTCCAGGATGCGGGCTCCC 0: 1
1: 0
2: 0
3: 12
4: 150
Right 1119322369 14:73739567-73739589 TCCCCTTGGTTGCACTGTAGAGG 0: 1
1: 0
2: 0
3: 10
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119322369 Original CRISPR TCCCCTTGGTTGCACTGTAG AGG Exonic
901287017 1:8088560-8088582 TCCCCTAGGTTGGAGTGCAGTGG + Intergenic
902586609 1:17442960-17442982 TCACCTAGGCTGGACTGTAGTGG + Intergenic
903825459 1:26141780-26141802 TCCCCCAGGTTGCAGTGCAGTGG - Intergenic
903893850 1:26589533-26589555 TCCCCTAGGCTGCAGTGCAGTGG + Intergenic
903984469 1:27215714-27215736 TCACCTGGGCTGCAGTGTAGTGG - Intergenic
905070477 1:35220836-35220858 CCCCCTGGGTTGCAGTGCAGTGG + Intergenic
905134611 1:35788917-35788939 TCCCCTAGGCTGGAGTGTAGTGG + Intergenic
905349784 1:37337522-37337544 TCCCCATGGCTCCACTGAAGGGG + Intergenic
906311574 1:44758155-44758177 GCCCCTTGTTTACACTGTTGGGG + Intronic
909933717 1:81527670-81527692 TCCCCTAGGTTGGAGTGCAGTGG - Intronic
910096912 1:83533676-83533698 CCCCCTTGGATGCACTGCAGAGG - Intergenic
910508278 1:87975440-87975462 TCCCCTGAGTGGCCCTGTAGGGG + Intergenic
910854890 1:91685360-91685382 TCCCCTAGGATGGACTGCAGTGG + Intronic
917343367 1:174003698-174003720 TCCCCTAGGCTGGAGTGTAGTGG + Intronic
918867886 1:189926526-189926548 TCCCCCTGGCTGGACTGCAGCGG - Intergenic
1063688065 10:8257474-8257496 TCCCCTAGGCTGCAGTGCAGTGG + Intergenic
1064758880 10:18598509-18598531 TCACCTAGGTTGCAGTGCAGTGG + Intronic
1064910742 10:20399103-20399125 TCCCCCAGGCTGCAGTGTAGTGG - Intergenic
1065902086 10:30217458-30217480 TCACCTAGGTTGCAGTGCAGTGG + Intergenic
1067415007 10:46096150-46096172 TCCCCATGGTGGTCCTGTAGGGG - Intergenic
1067438700 10:46296267-46296289 TCCCCCTGGTGGTCCTGTAGGGG + Intronic
1070155486 10:73831818-73831840 TCCCCCTGGCTGGAGTGTAGTGG - Intronic
1070285047 10:75076767-75076789 TCTCCTAGGCTGCAGTGTAGTGG - Intergenic
1070396982 10:76019989-76020011 TCCCCTTGATTCCACTCCAGAGG + Intronic
1072506199 10:96070094-96070116 TACCCTTGCTTGTACTGTAGGGG + Intergenic
1078219718 11:9341506-9341528 TCACCTTGGTTGGAGTGCAGTGG + Intergenic
1078272074 11:9805204-9805226 TCACCTAGGTTGGAGTGTAGTGG - Intronic
1078749806 11:14150759-14150781 TAGCCTTAGTTGCACTGTAGTGG - Intronic
1081849281 11:46263822-46263844 TCTCCTAGGCTGCAGTGTAGTGG - Intergenic
1084686699 11:70700361-70700383 TGCCCCTGGCTGCACTGGAGGGG - Intronic
1085952538 11:81349626-81349648 TCCCCGAGGCTGCACTGTGGAGG - Intergenic
1086291765 11:85318576-85318598 TCCACTTGGTTGAAATGTAAGGG + Intronic
1086406944 11:86506751-86506773 TCCCCATGGTTGAACTGTCCAGG + Intronic
1088054857 11:105562850-105562872 TCACCTTGATTGTAGTGTAGTGG + Intergenic
1090408670 11:126492807-126492829 TCCTCTTGGATGCTCTGGAGAGG + Intronic
1091082368 11:132682650-132682672 TCTCCCTGGTTGCTCTCTAGAGG - Intronic
1092124081 12:6063742-6063764 TCACCTGGGTTGCACTGTGCCGG - Intronic
1092983440 12:13820855-13820877 TCTTCTTGGTAGCAGTGTAGAGG - Intronic
1095495690 12:42781386-42781408 TCGCCCTGGTTGCAGTGCAGTGG + Intergenic
1096973833 12:55687215-55687237 TCCCCCAGGTTGCAGTGCAGTGG + Intronic
1097975887 12:65685349-65685371 TCCCCTAGGCTGGAGTGTAGTGG - Intergenic
1098086455 12:66849574-66849596 TCACCTAGGCTGCAGTGTAGTGG - Intergenic
1099064553 12:77957702-77957724 TCCCCCTGGCTGGAGTGTAGTGG + Intronic
1099318302 12:81111846-81111868 TCCCCTTGTTTGCATCCTAGAGG - Intronic
1101573902 12:105980053-105980075 TGCCCTTGGGTGCACTTTTGTGG + Intergenic
1103237305 12:119384154-119384176 TCCCCTAGGCTGGAGTGTAGTGG - Intronic
1103711170 12:122913779-122913801 TCCCCTAGGCTGGACTGCAGTGG - Intergenic
1105383536 13:19909778-19909800 CCTCCTGGGTTGCACTTTAGAGG - Intergenic
1109614887 13:64819919-64819941 TCACCTTGGTTGGAGTGCAGTGG + Intergenic
1111272377 13:85903288-85903310 TCACCATGGTTGGAGTGTAGTGG - Intergenic
1113469560 13:110534660-110534682 CCCCCTGGGGTGCACAGTAGAGG - Intronic
1115023849 14:28716201-28716223 TCCCCCAGGCTGCAGTGTAGTGG - Intergenic
1116845328 14:49860188-49860210 TCCCCTTGGCTGGAATGCAGTGG + Intergenic
1119322369 14:73739567-73739589 TCCCCTTGGTTGCACTGTAGAGG + Exonic
1119779112 14:77266412-77266434 TCCCCTTGGCCACACTGGAGAGG - Exonic
1124858246 15:33411782-33411804 TCCCTCTGGTTGCACGGTAATGG + Intronic
1124879436 15:33627747-33627769 TCCCACTGGTTGCAGTGTAGAGG + Intronic
1126500061 15:49335558-49335580 TCCCCTTGGTTCCTCTGTGAAGG - Intronic
1126501709 15:49353283-49353305 AACCCTTGATTGCACTGAAGAGG - Intronic
1127226595 15:56937394-56937416 TCTCCTCGGTTGGAGTGTAGTGG + Intronic
1128636168 15:69303849-69303871 TCCCCATGGATGGAATGTAGAGG - Intronic
1131107226 15:89743518-89743540 TCCCCTTGCTGGCTCTGCAGAGG - Exonic
1131457770 15:92596750-92596772 TGCCCATGGTTGAACTGAAGAGG - Intergenic
1132008441 15:98252576-98252598 TCAGCTTGGTTGCAGTGCAGTGG - Intergenic
1132457405 16:31807-31829 TCCCATTGTGTACACTGTAGAGG + Intergenic
1133400770 16:5485017-5485039 TCACCTAGGTTGCAGTGCAGTGG - Intergenic
1133497747 16:6335736-6335758 TCCCCCAGGCTGGACTGTAGTGG - Intronic
1133570225 16:7033478-7033500 TCCCCTAGGCTGGACTGCAGTGG - Intronic
1133662895 16:7936096-7936118 TCACCTAGGTTGGACTGCAGTGG + Intergenic
1135262556 16:20993721-20993743 TCGCCCTGGTTGCAGTGCAGTGG + Intronic
1136097525 16:27967871-27967893 TCACCTAGGTTGGACTGCAGTGG - Intronic
1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG + Intronic
1137444524 16:48523645-48523667 TCCCCTTGGTGACATTGTGGTGG - Intergenic
1138230239 16:55331206-55331228 TCCCATTGGTTGGCCTGTACCGG - Intergenic
1139606217 16:68020587-68020609 TCCCCTAGGCTGGAGTGTAGTGG + Intronic
1139696760 16:68680637-68680659 TCGCCCAGGTTGCAGTGTAGTGG - Intronic
1144489739 17:15698560-15698582 TCACCTTTATTGCACTGTATTGG + Intergenic
1144911225 17:18683399-18683421 TCACCTTTATTGCACTGTATTGG - Intergenic
1145952583 17:28831033-28831055 TCACCTTGGCTGGAATGTAGTGG + Intronic
1148049286 17:44761169-44761191 ACCCCGTGGTTACACTGTGGGGG + Intronic
1148741840 17:49897489-49897511 TCCCCTTGGTTTCCCTCTTGGGG - Intergenic
1150677121 17:67254288-67254310 TCCCCCAGGTTGGAGTGTAGTGG + Intergenic
1151686290 17:75648711-75648733 TCACCCAGGCTGCACTGTAGTGG + Intronic
1152350269 17:79780303-79780325 TTCCCTTTTTTCCACTGTAGCGG + Intronic
1153108176 18:1551845-1551867 TCCCCTAGGCTGCAGTGCAGTGG + Intergenic
1153796784 18:8630926-8630948 TCCCCTAGGCTGCAGTGCAGTGG + Intronic
1153992759 18:10414696-10414718 TTCCCTTGCTTGCCCTGTAAAGG + Intergenic
1155184006 18:23371831-23371853 TCCCCTCGGTTGAGCTGTAGGGG - Intronic
1155553794 18:26995396-26995418 TCACCCGGGTTGCAGTGTAGTGG - Intronic
1159200869 18:65182772-65182794 TCCCCTTGGCTGGAGTGCAGTGG + Intergenic
1160285818 18:77542150-77542172 TCACCTAGGTTGGAGTGTAGTGG - Intergenic
1162058281 19:8078819-8078841 TCCCCTAGGCTGGACTGCAGTGG + Intronic
1162399610 19:10437161-10437183 TCCCCTAGGCTGCAGTGCAGTGG + Intronic
1162483883 19:10946578-10946600 TCACCTAGGTTGGACTGTAGTGG - Intergenic
1162538622 19:11279467-11279489 TCCCCCAGGTTGGACTGCAGTGG - Intergenic
1162657073 19:12139568-12139590 TCCCCTAGGTTGGAGTGCAGTGG + Intronic
1162811942 19:13169567-13169589 TCACCCAGGTTGCAATGTAGTGG + Intergenic
1162887418 19:13706010-13706032 TCACCTAGGTTGGAATGTAGTGG - Intergenic
1162898058 19:13777283-13777305 TCCCCCAGGCTGCAGTGTAGTGG + Intronic
1163298877 19:16430404-16430426 TCACCTTGGTTGCACAGTTGTGG - Intronic
1164070182 19:21760453-21760475 TCCCCTAGGCTGGAGTGTAGTGG - Intronic
1164426474 19:28146272-28146294 TCCCCTCGGATGCACTGTCCTGG + Intergenic
1164857683 19:31537643-31537665 TCACCTTGGTTGCTCTTTTGGGG + Intergenic
1165762463 19:38329723-38329745 TCCCCCTAGTTGCTCTGGAGAGG + Intergenic
1166408691 19:42542048-42542070 TCGCCCAGGTTGCAGTGTAGTGG + Intronic
925134110 2:1514587-1514609 TCCCCGGGGTGGCACTGAAGAGG + Intronic
925521210 2:4747695-4747717 TCACCTAGGTTGCAGTGCAGTGG - Intergenic
926465942 2:13188130-13188152 TCCCCTAGGATGGACTGCAGTGG - Intergenic
927640513 2:24842595-24842617 TCCCCTCAGTTGCTCTGAAGGGG - Intronic
930707550 2:54519731-54519753 TCCCTCTGGTAGCATTGTAGGGG + Intronic
931611077 2:64101865-64101887 TCGCCTAGGTTGCAGTGCAGTGG + Intronic
931989665 2:67777215-67777237 TGCCCTTGGGTGCTCTGCAGAGG + Intergenic
932599857 2:73116164-73116186 TACCCTTGGTTTCACTGATGAGG + Intronic
932683346 2:73846584-73846606 TCACCTAGGCTGGACTGTAGTGG - Intronic
933350698 2:81148665-81148687 TCCCCTTGGATGCGCTATATCGG - Intergenic
935432634 2:102992734-102992756 TCGCCTAGGTTGGAGTGTAGTGG - Intergenic
936129497 2:109822617-109822639 TCACCTGGGCTGCAGTGTAGTGG + Intronic
936215200 2:110548868-110548890 TCACCTGGGCTGCAGTGTAGTGG - Intronic
936424337 2:112403441-112403463 TCACCTGGGCTGCAGTGTAGTGG - Intronic
936477780 2:112855001-112855023 TCGCCTAGGCTGCAATGTAGTGG + Intergenic
936603121 2:113919782-113919804 TCACCTAGGTTGCAGTGCAGTGG + Intronic
936657187 2:114501973-114501995 TCCCCTAGGCTGGAGTGTAGTGG + Intronic
939318673 2:140586580-140586602 TCCTCTAGGTGACACTGTAGAGG + Intronic
940498453 2:154464344-154464366 TCCCCTAGGTTTCACGGCAGAGG + Intergenic
942289161 2:174452683-174452705 TCACCTAGGTTGCAGTGCAGTGG + Intronic
943507399 2:188779069-188779091 TCACCTAGGTTGGAATGTAGTGG + Intronic
944738257 2:202587690-202587712 TCGCCTGGGTTGCAGTGCAGTGG - Intergenic
945078883 2:206068737-206068759 TCACCTAGGTTGGAGTGTAGTGG + Intronic
1170161849 20:13321160-13321182 TCACCTAGGCTGCAGTGTAGTGG - Intergenic
1170465054 20:16614978-16615000 TCCCCTAGGTTGAAGTATAGTGG - Intergenic
1172215315 20:33231603-33231625 TCGCCTAGGCTGAACTGTAGTGG - Intergenic
1172254589 20:33506048-33506070 TCCCCTAGGTTGGAGTGCAGTGG - Intronic
1172386433 20:34537165-34537187 TCACCTTGGCAGCACTGCAGGGG + Intronic
1172592462 20:36127445-36127467 TCCCCATGGATGCACTGTGTTGG + Intronic
1178320589 21:31602182-31602204 TCCCCTAGGCTGGAGTGTAGTGG - Intergenic
1178748470 21:35277494-35277516 TCACCTAGGTTGAAGTGTAGTGG + Intronic
1179767675 21:43585268-43585290 TCACCTAGGCTGGACTGTAGTGG - Intronic
1180600168 22:17010214-17010236 TCCCATTGTGCGCACTGTAGGGG - Intergenic
1181085404 22:20437392-20437414 TTCCCTGGGATGCACTGTCGTGG + Intronic
1181569377 22:23759678-23759700 CCTCCTTGGTGGCACTGAAGAGG - Intergenic
1183985558 22:41568321-41568343 TCCCCCAGGCTGCACTGCAGAGG + Intronic
1184103072 22:42351791-42351813 TCCCTTTGGTTGTTCTGCAGGGG + Intergenic
1184418643 22:44366569-44366591 TCCCCTTGGCTGCCCTGGTGGGG + Intergenic
1185159242 22:49212894-49212916 TCGCCCAGGTTGGACTGTAGTGG + Intergenic
949437550 3:4046009-4046031 TCCCCCAGGTTGGACAGTAGTGG - Intronic
950512121 3:13436549-13436571 TCCCCTTGGCTGGAGTGCAGTGG - Intergenic
953735445 3:45490245-45490267 TCCCCTTTCTTGCCCTGTAGAGG - Intronic
954437876 3:50505428-50505450 TCCTCTTGGGTGCCCTGTCGGGG + Intergenic
955324857 3:58002085-58002107 TCCCCTAGGCTGCAGTGCAGTGG - Intergenic
955720768 3:61878531-61878553 TCACCCAGGTTGCAGTGTAGTGG + Intronic
956506074 3:69941620-69941642 TTCCCTTGGCTGCAGTGTACTGG - Intronic
958997224 3:100918446-100918468 TCTCCTTGGGTGAAGTGTAGAGG + Intronic
961222796 3:125213011-125213033 TTCCGCTGGTTGCACTGTCGAGG - Intergenic
961258701 3:125581654-125581676 TCACCTAGGCTGCAGTGTAGTGG - Intronic
965700255 3:171453418-171453440 CCCCCATGGATGCTCTGTAGGGG - Intronic
966816567 3:183894810-183894832 TCACCCAGGTTGGACTGTAGTGG + Intergenic
968048965 3:195641093-195641115 TCCCCCAGGCTGGACTGTAGTGG - Intergenic
968219601 3:196926676-196926698 TCCCCTGGGTTGGAGTGCAGTGG + Intronic
969552019 4:7876188-7876210 GCCTCATGGTCGCACTGTAGAGG - Intronic
970662376 4:18300207-18300229 TCACCTTGGCTGAAGTGTAGTGG - Intergenic
971016658 4:22495867-22495889 TCCCCCAGGCTGCAGTGTAGTGG - Intronic
971911549 4:32801986-32802008 CCCCCTTGGTTGCACCATGGGGG + Intergenic
979086229 4:116412636-116412658 TCCCCTGGGCTGAAGTGTAGTGG + Intergenic
980771926 4:137384921-137384943 TGCCCTTGGCTGGAGTGTAGTGG + Intergenic
980867817 4:138574109-138574131 TCCCCCAGGTTGCAATGCAGTGG + Intergenic
981591887 4:146373432-146373454 TCGCCTAGGTTGGAGTGTAGTGG - Intronic
981881128 4:149614123-149614145 TCCCCTTGGTGGGAGTGTTGAGG + Intergenic
981974154 4:150703119-150703141 TCGCCTAGGTTGGAGTGTAGTGG - Intronic
986832673 5:11598309-11598331 CCCCCTTGGTTGTGGTGTAGAGG - Intronic
987207388 5:15641437-15641459 TCCTCTTGGTTTCCCTGTGGAGG - Intronic
987676000 5:21073211-21073233 TCGCCCAGGTTGCACTGCAGTGG - Intergenic
991354472 5:65753608-65753630 TCCCCTAGGTTGGAGTATAGTGG - Intronic
991922353 5:71669106-71669128 TCTCCCAGGTTGCAGTGTAGTGG - Intergenic
997946647 5:138208826-138208848 TCTCCTGGGCTGCAGTGTAGTGG + Intronic
998221273 5:140282776-140282798 TTCCCTTGGTTCCAGTGGAGGGG - Intronic
998259758 5:140620971-140620993 TCCCCCAGGTTGGAGTGTAGTGG - Intergenic
1002485563 5:179533623-179533645 TCCCCCAGGTTGGAGTGTAGTGG - Intergenic
1002709371 5:181185205-181185227 TCACCCAGGTTGGACTGTAGTGG - Intergenic
1005145148 6:22681107-22681129 TCCCCCAGGTTGCAGTGCAGTGG + Intergenic
1005719127 6:28583340-28583362 TCCCCTGGGCTGCAGTGTAGTGG - Intronic
1006500154 6:34453200-34453222 TCGCCTTGGCTGGACTGCAGTGG - Intergenic
1006859671 6:37162577-37162599 TCGCCCTGGTTGGAGTGTAGTGG + Intergenic
1008621906 6:53279020-53279042 TCCCCTTGGCTACTGTGTAGCGG - Intronic
1009170124 6:60388614-60388636 TCACCTAGGTTGGAGTGTAGTGG + Intergenic
1009318570 6:62256093-62256115 TCCCCTAGGTTGGAGTGCAGTGG - Intronic
1009323743 6:62323810-62323832 TCCTCTTGGTTTTCCTGTAGTGG + Intergenic
1011935812 6:92776239-92776261 TCCCCCAGGCTGAACTGTAGTGG + Intergenic
1012988619 6:105901488-105901510 TCGCCTAGGTTGGACTGCAGTGG + Intergenic
1014778842 6:125540504-125540526 TCACCTTGGCTGGAGTGTAGTGG + Intergenic
1015472657 6:133623332-133623354 TCCCCTGGGTAGCACTGGAGTGG - Intergenic
1015680791 6:135806174-135806196 TCACCTAGGCTGCAGTGTAGTGG + Intergenic
1015948084 6:138523347-138523369 TCACCTAGGCTGCAGTGTAGTGG + Intronic
1016277647 6:142373576-142373598 TCCCCCAGGGTGGACTGTAGTGG + Intronic
1016469001 6:144355245-144355267 TCACCTTGGCTGGAGTGTAGTGG + Intronic
1017144029 6:151217683-151217705 TCCCCCAGGCTGGACTGTAGTGG + Intergenic
1018294981 6:162336041-162336063 TGCCCTTGCTTACCCTGTAGAGG - Intronic
1018629109 6:165806686-165806708 TCACATTGGCTGCACTGAAGGGG - Intronic
1019658060 7:2208429-2208451 CACCCCTGGTTGCACTGTACTGG - Intronic
1019804109 7:3110171-3110193 TCCCCTAGGCTGGAGTGTAGTGG - Intergenic
1019877625 7:3828236-3828258 TCGCCTTGGTTGGAGTGCAGTGG - Intronic
1023449558 7:40268687-40268709 TCCCCTAGGTTGGAGTGCAGTGG + Intronic
1026214139 7:68333305-68333327 TCACCTAGGTTGCAGTGCAGTGG + Intergenic
1034478408 7:151302082-151302104 TGCCCTTGGTGCCACTGTACTGG + Intergenic
1036193667 8:6694871-6694893 TCACCTTGGCTGGAGTGTAGTGG - Intergenic
1036808056 8:11848612-11848634 TCGCCTTGGTTCCGCAGTAGCGG - Intronic
1038771689 8:30488639-30488661 TCCCCTTGATTTATCTGTAGAGG + Intronic
1042850538 8:73211943-73211965 ACCCCTTGGTTGGACTTCAGAGG + Intergenic
1042973611 8:74438638-74438660 TCACCTTGGTTGGAGTGCAGTGG + Intronic
1044752865 8:95432795-95432817 TTCCCTTGATTACACTGGAGGGG + Intergenic
1045906452 8:107351639-107351661 TTCACTTGGTTTCACTATAGTGG + Intronic
1047785685 8:128151962-128151984 TCCCCTGGGCTGCTCTGCAGTGG - Intergenic
1049696767 8:143987849-143987871 TCACCTTGGTTGGAGTGCAGTGG - Intronic
1052186949 9:25609417-25609439 TCCCCCAGGTTGCAGTGCAGTGG - Intergenic
1053298132 9:36929682-36929704 TCCCAATGGTTGCATTGCAGTGG - Intronic
1055030152 9:71766106-71766128 TCACCTAGGTTGGAGTGTAGTGG + Intronic
1055572643 9:77632456-77632478 TCCCCTCTGTGGCCCTGTAGGGG + Intronic
1056875800 9:90329439-90329461 TCACCTGGGTTCCACTGCAGTGG + Intergenic
1058688959 9:107503104-107503126 TTGCCTGGGTTGGACTGTAGTGG - Intergenic
1060588839 9:124803300-124803322 TCACCCAGGTTGCAGTGTAGTGG + Intronic
1185608085 X:1378652-1378674 TCCTCCTGGTCGCACTCTAGGGG - Exonic
1185770612 X:2763051-2763073 TCACCCAGGTTGCAGTGTAGTGG + Intronic
1185969453 X:4646158-4646180 TCTCCTTGGCTGCTCTGTGGGGG - Intergenic
1187065175 X:15827879-15827901 TGCCATTGGTTGCACTGGGGAGG - Intronic
1188669208 X:32862774-32862796 TCACCTTGGCTGGAGTGTAGTGG + Intronic
1190079050 X:47340997-47341019 TCACCTGGGTTGGAGTGTAGTGG + Intergenic
1190860326 X:54338534-54338556 TCACCCAGGTTGGACTGTAGTGG - Intronic
1193643101 X:84035898-84035920 TCCCCTAGGTTGGAGTGCAGTGG + Intergenic
1195310208 X:103625021-103625043 TCCCCTTGGTTTCACTTTGCAGG - Intronic
1195311807 X:103638980-103639002 TCCCCTTGGTTTCACTTTGCAGG - Intergenic
1195686867 X:107595275-107595297 TCACCTAGGTTGGAGTGTAGTGG - Intronic
1196501470 X:116388263-116388285 TGCCCTTGGTTTCTCTGTACAGG + Intergenic
1196739074 X:119008309-119008331 TCCCCCTGCTGGGACTGTAGGGG + Intronic
1197197920 X:123721744-123721766 TCGCCTAGGCTGCAGTGTAGTGG - Intronic
1198277688 X:135112224-135112246 TGCCCTTGGTTTCTCAGTAGCGG + Intergenic
1199143775 X:144340469-144340491 TCTCTTTGGTTGCAGTGTATGGG - Intergenic
1200398952 X:156007577-156007599 TCCCATTGTGTACACTGTAGAGG - Exonic
1201918528 Y:19208833-19208855 TCCTCTGTGTTACACTGTAGTGG - Intergenic