ID: 1119324222

View in Genome Browser
Species Human (GRCh38)
Location 14:73750010-73750032
Sequence CTGCTTTTCCCTAGGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 324}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119324217_1119324222 9 Left 1119324217 14:73749978-73750000 CCTTTGGGATTGCAACAGCTTGT 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1119324222 14:73750010-73750032 CTGCTTTTCCCTAGGAAAAATGG 0: 1
1: 0
2: 0
3: 29
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119324222 Original CRISPR CTGCTTTTCCCTAGGAAAAA TGG Intronic
901567816 1:10133164-10133186 CTGCTTTGCCAGAGGAGAAAAGG + Intronic
902088304 1:13880396-13880418 TTGCTTTTCCCGATGAATAATGG + Intergenic
902236794 1:15062862-15062884 CTGAGGCTCCCTAGGAAAAAGGG + Intronic
903356407 1:22750617-22750639 CTGCTTTTCCCAATTGAAAAGGG - Intronic
904141022 1:28353187-28353209 CTGCTTTTACCTGGGCCAAATGG - Intergenic
905354608 1:37372654-37372676 ATTCTTTTCTCTAGGCAAAAGGG - Intergenic
906285497 1:44585037-44585059 CTGCCTTTCCCTAGGATGCATGG - Intronic
906776430 1:48533993-48534015 TTGATTTTCCATTGGAAAAAGGG + Exonic
907179175 1:52553936-52553958 CTGCCTTTTCAAAGGAAAAAAGG - Intergenic
908463179 1:64366282-64366304 CTGCTTCTCCCTGGGAAAGGTGG - Intergenic
910494099 1:87806711-87806733 CTGTTTTGCCTTATGAAAAAGGG + Intergenic
910627726 1:89325988-89326010 CTGCTGTTACCTAGGTAAACAGG + Intergenic
910759383 1:90719468-90719490 CTGCGTTTTCCTAGGGAAATCGG + Intergenic
911198443 1:95019543-95019565 CTGATTTTCCCTAAGATACATGG - Intronic
911656278 1:100447629-100447651 TTATTTTTCCCTAGGACAAAAGG - Intronic
914857799 1:151365036-151365058 CTGGTTTTCCCAAGGGAAAACGG - Exonic
915168016 1:153959327-153959349 CTGCTGTACCCTAGGAATATGGG - Exonic
915623900 1:157102865-157102887 CTGCTTCACCTTAGGAAAATGGG + Intergenic
915752070 1:158221070-158221092 CTGCTGATACCTAGGGAAAAAGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917368582 1:174262049-174262071 CTCTTTTTCCATAGGAAAACAGG + Intronic
917675613 1:177316372-177316394 CTGCTTTCCCAAAGGATAAAAGG + Intergenic
917949491 1:180015836-180015858 CTGGTTTGGCCTAGGAGAAAAGG - Exonic
918007299 1:180553916-180553938 CTGCTTGTACATAGGAAAAAGGG + Intergenic
918238920 1:182604632-182604654 GTACTTTTCCCTAGGAAACTGGG - Intergenic
920903042 1:210131699-210131721 ATGCTTTTCACTATGGAAAAAGG - Intronic
921288408 1:213630849-213630871 CTGCTTATACCCAGGAAAACAGG - Intergenic
921419886 1:214934196-214934218 CTGCTTTTCCCTAGCAGAGTTGG + Intergenic
922980060 1:229818162-229818184 CTCCTCCTCCCTATGAAAAAGGG + Intergenic
923105146 1:230848735-230848757 CTGCTTTCCCCAAAGGAAAAGGG + Intronic
923587603 1:235288644-235288666 CTGTTTTTCCCTATTAAAGAGGG + Intronic
924833873 1:247628615-247628637 CTGCTTTTCTCAAGTAGAAAGGG + Intergenic
1062841706 10:678284-678306 CTGCTTTTCCAGAGGAAAGCTGG - Intronic
1063005475 10:1966224-1966246 CTGCACTTCCCTAGGAACAAGGG - Intergenic
1063057102 10:2517781-2517803 CTACTTTTTTCTAGGAATAATGG - Intergenic
1063969443 10:11371320-11371342 CTACGTTTCCCAAGGAACAAAGG + Intergenic
1064384106 10:14875967-14875989 CTGCTTTTGGCTAGGCAAAGTGG - Intergenic
1066274216 10:33853019-33853041 CTGCTGATACCTAGGCAAAAAGG - Intergenic
1067759279 10:49031069-49031091 ATGCTTTTGCTTAGAAAAAAGGG + Intronic
1068547235 10:58361282-58361304 CTTCTTTTCCCAATGAAACAAGG - Intronic
1068658384 10:59597250-59597272 CTACTTTTGCCTCTGAAAAATGG - Intergenic
1069555685 10:69396348-69396370 CTGCTCTTACCCAGGCAAAATGG + Intronic
1070629153 10:78072150-78072172 CTTCTTTTCCCAGGGACAAAAGG + Intergenic
1070703734 10:78622255-78622277 CTAATTTTCCCTGGGAAGAAGGG - Intergenic
1070886639 10:79905340-79905362 GTGCTTTTCCCAAGAAGAAAAGG + Intergenic
1071257186 10:83881352-83881374 CTTCTTTTCCCTAGGCAACTAGG + Intergenic
1073725518 10:106225974-106225996 CAGCATTTCCCAAGGCAAAAAGG + Intergenic
1074065476 10:110008602-110008624 CTGGTTTTCCCTAGGAAGGCGGG + Intronic
1074664765 10:115708349-115708371 CTTCTTTTCCCTGAGAAAATTGG + Intronic
1078557779 11:12344416-12344438 CTTCTTTTCCATATGAAAAACGG - Intronic
1079129144 11:17737450-17737472 CAGCTTGTTCCTAGGAAGAAAGG + Intronic
1079602914 11:22331837-22331859 CTTCTTTGTACTAGGAAAAAAGG + Intergenic
1079977061 11:27104959-27104981 CTGCTGATACCTAGGAAAACAGG + Intronic
1080184349 11:29462536-29462558 TTCCTTTTTCCTAGGAAAAGAGG - Intergenic
1080266704 11:30408706-30408728 ATAACTTTCCCTAGGAAAAATGG - Intronic
1081789790 11:45774614-45774636 CAGCTTTCCCCTCTGAAAAATGG + Intergenic
1083243486 11:61407511-61407533 CTGCTTTTCCAGAGGATACATGG + Intronic
1083323693 11:61862776-61862798 CAGCATTTCCCTAGAAACAAAGG + Intronic
1084634449 11:70381533-70381555 CTGCTCCTCCCCAGGAGAAAAGG + Intronic
1085629705 11:78104431-78104453 CTGCTTTTCCCACAGACAAAAGG + Exonic
1085650986 11:78268533-78268555 CTGCTTATCCCTATTAAAAGAGG - Intronic
1086329350 11:85738121-85738143 CTGCTTTTCCCCATGAAGTAAGG + Intronic
1086367070 11:86118017-86118039 CAGCTTTTCTATAGGTAAAATGG + Intergenic
1086930176 11:92684025-92684047 CTGGTTTTCCCTAAGAATGAAGG + Intronic
1087602150 11:100329754-100329776 CTCCCTTTCCCTAGCAATAAGGG - Intronic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1088726083 11:112636468-112636490 CTGCTTTTATGAAGGAAAAAAGG + Intergenic
1088727107 11:112648981-112649003 TTGCATTTCTGTAGGAAAAAGGG + Intergenic
1089068633 11:115681306-115681328 CTACTTCTGCCTAGGAAAGAAGG + Intergenic
1089643536 11:119863463-119863485 CTCCTCTCCTCTAGGAAAAAGGG - Intergenic
1090680732 11:129054581-129054603 ATGCCTTTACCTAGAAAAAAGGG + Intronic
1090858648 11:130633613-130633635 ATGCCTTTCTCTAGGAAAGAAGG - Intergenic
1093388953 12:18593672-18593694 CAGCTTTTCCTTAGTAAAACTGG - Intronic
1094262086 12:28512280-28512302 GTGTTTTTCCCTTGGGAAAAGGG - Intronic
1094292431 12:28866984-28867006 ATGCTTTTTCCAAGGAGAAAGGG + Intergenic
1095464139 12:42472964-42472986 CTACTATGCCCCAGGAAAAATGG + Intronic
1097302042 12:58029281-58029303 CTGCTTTCCCCAAAGAACAATGG + Intergenic
1097449974 12:59725472-59725494 CTCCATTTCCCTATTAAAAATGG + Intronic
1098568900 12:71967268-71967290 CTCCTTTTCTCTAGGAAGAGTGG + Intronic
1098657389 12:73050301-73050323 GTCCTATTCCCTAGGAAACAGGG - Intergenic
1099138405 12:78938219-78938241 CAGCTTTTCTCCAGGAAAATAGG + Intronic
1099774431 12:87106022-87106044 CCTCTTTTCACAAGGAAAAAGGG - Intergenic
1099838758 12:87939641-87939663 CTGTTTTTGCATATGAAAAATGG + Intergenic
1100943190 12:99747429-99747451 TTGCATTTCTCTGGGAAAAAGGG - Intronic
1101019774 12:100541974-100541996 CAGCTTTTCCATTTGAAAAATGG - Intronic
1101245973 12:102884767-102884789 CTGATTTTTCCCAGGCAAAAAGG + Intronic
1102820778 12:115907576-115907598 CCGCTTGTCCATAGGAACAATGG + Intergenic
1102911336 12:116716577-116716599 CTGCATTACAGTAGGAAAAATGG + Exonic
1104638961 12:130455191-130455213 CTGTTTTCCCCTGGGAAGAACGG + Intronic
1106816337 13:33411523-33411545 CTGCTGTTCCCAAGAAACAAAGG + Intergenic
1109248579 13:59988890-59988912 CCCCTTTTCCCTGGGAAAAAGGG - Intronic
1110360883 13:74624046-74624068 CTGCTATTCCATAGGAAAGTGGG - Intergenic
1110883997 13:80609613-80609635 TTGCTTTGAGCTAGGAAAAATGG + Intergenic
1111255832 13:85667199-85667221 TTGCTATACCCTAGGAATAAGGG - Intergenic
1111346748 13:86966953-86966975 CTGCTTTTTTCTAGCAAAATTGG - Intergenic
1113403521 13:110017692-110017714 CAGTTTTTCTGTAGGAAAAAAGG - Intergenic
1113411016 13:110089926-110089948 CTTCTTTTCTCCAGGAAATATGG - Intergenic
1113542470 13:111119703-111119725 CTGATGTTGCATAGGAAAAAAGG + Intronic
1115372189 14:32629265-32629287 GTTCTTTTCCAAAGGAAAAAAGG - Intronic
1115711213 14:36053364-36053386 CTTCTTTTGCCTACAAAAAAAGG - Intergenic
1117556506 14:56891457-56891479 GTGTTTTGCCCTAGGCAAAAAGG - Intergenic
1118050544 14:62021584-62021606 CTATTTTTTCCTAGGAAAGATGG + Intronic
1118508066 14:66437538-66437560 TTTATTTTCCCTAGGAACAATGG - Intergenic
1119324222 14:73750010-73750032 CTGCTTTTCCCTAGGAAAAATGG + Intronic
1120028087 14:79608535-79608557 CTGCTTATCCCTACTAAAAATGG - Intronic
1120035793 14:79696467-79696489 TTGCTTTTCCATATGAAGAAAGG - Intronic
1121524223 14:94607393-94607415 ATGCTTTTCCCTTTGAAAACTGG + Intronic
1121689679 14:95868187-95868209 CTGCTTTTTCATCTGAAAAATGG + Intergenic
1123215253 14:106803251-106803273 CTGCTTTTCATCAGCAAAAAGGG + Intergenic
1123707004 15:22957959-22957981 CTGGTTTTCCCCAGGTTAAACGG + Intronic
1124608760 15:31193277-31193299 CTGCTTTCCCTCAGGAAAAATGG + Intergenic
1126323605 15:47450820-47450842 CTGTTTTTCCCCAGTAACAATGG - Intronic
1126497031 15:49303140-49303162 TTTTTTTTCCCTAGGAAACAAGG - Intronic
1126921987 15:53537020-53537042 CTGTTTTTCATTAAGAAAAAAGG - Intronic
1127163148 15:56213189-56213211 CTGCATTTCTCTGGGATAAATGG - Intronic
1127777582 15:62278421-62278443 CATATTTTCCCTAGGAACAAGGG + Intergenic
1130931233 15:88429494-88429516 CTGCTCTTCTCTGGGACAAAGGG + Intergenic
1131505915 15:93019022-93019044 ATTCTTTTCCTTAGGAGAAAAGG + Intronic
1135245331 16:20851630-20851652 CATCTTTTTCTTAGGAAAAAGGG + Intronic
1137566835 16:49538568-49538590 CAGCTTTGCACTGGGAAAAAGGG - Intronic
1138896940 16:61218076-61218098 CAGCCTCTCCATAGGAAAAAAGG + Intergenic
1139254249 16:65525971-65525993 ATGCTTTTCTGTATGAAAAAAGG - Intergenic
1139447313 16:67005881-67005903 CTGTTCTTCCTTAGGAACAAGGG + Intronic
1139974270 16:70796473-70796495 CTGGTTTTCCCTACCAGAAAGGG - Intronic
1140887509 16:79258141-79258163 CTGCATTTCCCTAAGAAAGGAGG + Intergenic
1141158385 16:81612534-81612556 CTCCTTTTCCCTAAGAAACTGGG + Intronic
1141184361 16:81776480-81776502 CTTCTTTTCCCAAGGATAATAGG - Intronic
1141290766 16:82716298-82716320 CTGCTTTTCCATGGGAAAGGTGG + Intronic
1143122257 17:4615906-4615928 CTGCTTATCCCAAGGACAACAGG - Intergenic
1143750965 17:9027493-9027515 CTGCTTTTCCATAGAATGAATGG + Intronic
1144212722 17:13028904-13028926 CTGACTTTCCCAAAGAAAAAAGG - Intergenic
1145207661 17:20993188-20993210 CTGCTGTTTCCTGGGAACAAAGG - Intergenic
1145756098 17:27391112-27391134 GTGCATTTCCCTGGGGAAAAGGG + Intergenic
1147033327 17:37659906-37659928 CTGCTTTTCCCAAGGACCCAGGG - Intergenic
1148335862 17:46841080-46841102 AGGCTTATCCCTAGGAAAGAGGG + Intronic
1148463805 17:47852424-47852446 CTGCATTCCCCTGTGAAAAAAGG - Intronic
1149341420 17:55690402-55690424 CTGCTTTTGCTTGAGAAAAATGG + Intergenic
1150030574 17:61730161-61730183 CTGTTTTTCCCTAGGATTAAAGG - Intronic
1150820454 17:68430405-68430427 CTGCTTTCCCCTATTAAAGAAGG + Intronic
1151896369 17:76983330-76983352 CTGCTCTTCCCCAGGAAGCAGGG - Intergenic
1154935324 18:21049131-21049153 CTGCTTTTTTCTGGGAAGAAAGG - Exonic
1155318712 18:24597226-24597248 TTGTTCTTCTCTAGGAAAAAAGG + Intergenic
1155466029 18:26136260-26136282 TTTCTTTTCCCTAAGAAGAAAGG - Intronic
1158903104 18:61984700-61984722 CTTCTTTTCCCTTTGCAAAAGGG + Intergenic
1159239384 18:65721640-65721662 TTGCATTTCCCTAGGACTAATGG - Intergenic
1160400033 18:78603445-78603467 CTGTTTTTCCCTGAGACAAATGG - Intergenic
1162005225 19:7774053-7774075 CTGCCTTTCCCTAGGACCAGCGG + Intergenic
1166352541 19:42206870-42206892 CTGTTTTTCCCTCTGAAAAATGG - Intronic
1166776797 19:45318006-45318028 CTGCTTGTCCCCAGCAAACAGGG + Intronic
1167048604 19:47065976-47065998 CCCCTTTTCCCCAGGACAAAGGG - Exonic
1167229210 19:48271264-48271286 CTGCATTTCCCAAGGAAAGAAGG - Exonic
1167507141 19:49876789-49876811 CAGCTTGCCCCTAAGAAAAATGG + Exonic
925177012 2:1793183-1793205 CTGCATTTCTCTAAGGAAAAAGG + Intronic
925591405 2:5513411-5513433 CAGCTTTTCCTGAGGAAGAAGGG + Intergenic
926633971 2:15161557-15161579 CTGCTTCTCCCTTAGAAAAGGGG - Intergenic
926726128 2:15999413-15999435 CTTCTTTTCTCCAGGGAAAATGG + Intergenic
929381503 2:41359328-41359350 CTGCTTTTACCCAGGCAAACAGG + Intergenic
931205144 2:60139636-60139658 CTGCTTTCCCCTGGGAATGAGGG - Intergenic
932536597 2:72603757-72603779 CTACTTCTCCCTAGGAAAACTGG + Intronic
933430225 2:82167723-82167745 CTAGTTTTCTCTATGAAAAATGG - Intergenic
934654800 2:96111864-96111886 CTGCATTTCTCTAGTATAAAAGG + Intergenic
935161100 2:100530182-100530204 CAGCTTTTCATTAGGAAAACTGG + Intergenic
936171051 2:110175103-110175125 CTGCATTTCCCCAGGAGCAATGG + Intronic
936251020 2:110868391-110868413 CTCCTTTTCCCAAGAAGAAAAGG - Intronic
936715426 2:115181664-115181686 CTGCTTTGACCAAGGAAATATGG - Intronic
937471433 2:122177028-122177050 TCTATTTTCCCTAGGAAAAATGG - Intergenic
938508344 2:131911284-131911306 CTCTTTTTCCCTAAGAAAATAGG + Intergenic
938681499 2:133696387-133696409 CTGTTTTTCTCAAGGAAAAAGGG + Intergenic
938764411 2:134450731-134450753 CTGCTTGGGCCTAGGAAGAAGGG + Exonic
939127996 2:138201268-138201290 CTACTATTCTCTATGAAAAATGG - Intergenic
939462938 2:142520162-142520184 CTACTTTTCCCAAGAGAAAAAGG - Intergenic
939920658 2:148108112-148108134 TTGCATTTCCTTAGGGAAAAGGG + Intronic
940980928 2:160002517-160002539 CTAGTTTTCCCTATGAAAAAAGG + Intronic
942145940 2:173026240-173026262 CTTCTTTTCCCTGGTAAAAATGG - Intronic
942319353 2:174723046-174723068 CTGCTTAGACTTAGGAAAAATGG - Intergenic
943574330 2:189613464-189613486 CTTCTTTTTGCTAGGAAAAAAGG + Intergenic
944220042 2:197294074-197294096 CGGTTTCTCCCTATGAAAAATGG + Intronic
944282033 2:197909340-197909362 CTTCTGTTCCTTAGCAAAAAAGG - Intronic
946411366 2:219516879-219516901 GTGCTTTTCCCTAGGAAAGGGGG - Intronic
1169189500 20:3648915-3648937 CTTCTTTGGCCTAGGAAAACTGG - Exonic
1170551117 20:17477121-17477143 CTGCATTGCCCTAGGAACCAAGG - Intronic
1170878850 20:20277153-20277175 ATGATATTCCCTAGGAAAGAAGG - Exonic
1172614482 20:36274440-36274462 CTGCGTTTCCATAGGAACCAGGG + Intergenic
1173311806 20:41903369-41903391 TATCTTTTCCCTAGGGAAAAAGG - Intergenic
1175069153 20:56317001-56317023 TTCCTTTTCCATAGGAAAAGGGG + Intergenic
1175494253 20:59403268-59403290 GTGCCTTTCACTAGGAAAGAAGG + Intergenic
1176785149 21:13247279-13247301 CTCTTTTTCCCTAAGAAAATAGG - Intergenic
1177155261 21:17494848-17494870 GTGCTTGCCCGTAGGAAAAATGG - Intergenic
1177723596 21:24939221-24939243 TTGCTCTGCCCTGGGAAAAAAGG - Intergenic
1177784216 21:25653023-25653045 TTGCTTTTCCCTAGGCCACAAGG - Intronic
1177970154 21:27778759-27778781 CTTCTTTCCCCTCGGAAAACAGG + Intergenic
1177983187 21:27941037-27941059 CTCTTTTTCCCTAAGAAAATAGG - Intergenic
1178508068 21:33179311-33179333 CTTCCTTTCCCTGGCAAAAATGG + Intergenic
1180704084 22:17798074-17798096 CTGCATTTCCCCAGGGAACACGG + Intronic
1182161852 22:28130298-28130320 CTGCTTTTCCTTGGGAGCAAAGG - Intronic
1183168563 22:36166634-36166656 CTGCTTTACCCCAGGCAGAAGGG + Intergenic
1183292589 22:37012053-37012075 CAGTTTCTCCATAGGAAAAATGG + Intronic
950230671 3:11272822-11272844 CTGCTTTTCCATCTGCAAAATGG + Intronic
950612524 3:14135325-14135347 GTGCCTTTCCCCAGGGAAAAGGG - Intronic
950941590 3:16898458-16898480 CAGCTATTCCTTAGGACAAAAGG - Intronic
951273304 3:20654337-20654359 CTTCTTTTTCCAAGGAAGAAGGG + Intergenic
952462635 3:33544939-33544961 TTCCTTTTCCCTGGGAAAGATGG - Intronic
953019839 3:39106623-39106645 CTGCCTTTCACTAGGGAAAGGGG + Intronic
953470508 3:43162145-43162167 CTTACTTTCCCTAGGAAACAAGG + Intergenic
953812301 3:46123754-46123776 CTGCTTTTCCCTGGCAATTATGG - Intergenic
954936705 3:54333401-54333423 CAGCTTTTCCCTAGACACAAAGG - Intronic
955701949 3:61690367-61690389 CTGCTTTTCTCCAGGATAAATGG + Intronic
955976914 3:64488756-64488778 CTGCTTTTACAGAGGAAGAAAGG - Intergenic
958108306 3:89105849-89105871 CTGCTTGTCACTGGGAAAAAAGG - Intergenic
960444787 3:117734423-117734445 CTTCTCTTCCCTAGTAAAACTGG - Intergenic
961424842 3:126836908-126836930 CTGCTCTTCCTGAGGAGAAATGG + Intronic
962406708 3:135106693-135106715 CTGCTTTGCCCTGGGATCAAAGG - Intronic
962544732 3:136421154-136421176 CTTCTTCTCCCTATAAAAAAAGG + Exonic
963161880 3:142159522-142159544 CTGCATTCCTCTAGGAACAAGGG + Intergenic
963361741 3:144282527-144282549 CTTTTGTTCCCTAGGAGAAAAGG - Intergenic
966373119 3:179268850-179268872 CTGCTTTTCCAGAGTAAAAAGGG + Intergenic
966712582 3:182985121-182985143 CTGCTTTACCCTTTAAAAAATGG - Intronic
969759947 4:9174393-9174415 CTGGTTTTCCCCAGGAGATAGGG - Intronic
970259767 4:14212364-14212386 CTGCTGTTACCCAGGAAAACAGG - Intergenic
970743585 4:19267166-19267188 CTGCTTTACCTCAGGAAAAAAGG - Intergenic
971518446 4:27517944-27517966 AGGCTTTTCACTAGGGAAAATGG + Intergenic
972155437 4:36155453-36155475 CTGCTGTTCCCTATGCAAAGAGG - Intronic
972591925 4:40496077-40496099 CTGCTTTCCTCTGAGAAAAAAGG + Intronic
974310313 4:60199095-60199117 CTAGTTTTGCCTAAGAAAAATGG + Intergenic
976350195 4:84051982-84052004 CCGTTGTTCCTTAGGAAAAAAGG + Intergenic
977426934 4:96878087-96878109 TTTTTTTTCCCTAAGAAAAATGG + Intergenic
978270307 4:106881509-106881531 GTGATTTTCCACAGGAAAAATGG + Intergenic
981002191 4:139838677-139838699 CAAGTTTTCCATAGGAAAAATGG + Intronic
983305980 4:165987566-165987588 CTGCCTTTCCATTGGAAATAGGG + Intronic
983882271 4:172946858-172946880 CTGCTTTTCCATAACCAAAATGG - Intronic
984002527 4:174268155-174268177 CTGTAATTCCCTAGGAACAATGG - Intronic
984112006 4:175628409-175628431 ATGCTTTGGCCTAAGAAAAATGG + Intergenic
984481237 4:180305409-180305431 CTGTTTTTACCTTGGAAAATAGG + Intergenic
984578474 4:181479528-181479550 CTTCCTTTCTCTTGGAAAAATGG + Intergenic
986089455 5:4489592-4489614 CTGCCATTACCTTGGAAAAATGG + Intergenic
986317614 5:6601077-6601099 CTGCTTTACATTAGGAAAAATGG - Intronic
989231939 5:39096737-39096759 CTGGTTTTCCCTAGGAAGGAGGG + Intergenic
989704396 5:44311179-44311201 TTTTTTTTTCCTAGGAAAAATGG + Intronic
989802834 5:45565299-45565321 CTGCTATGCACTAGGAATAATGG - Intronic
991262887 5:64685900-64685922 CTGCTTTTCTCTGGGAATGAGGG + Intergenic
992222108 5:74583325-74583347 ATGATTTACCTTAGGAAAAAAGG + Intergenic
992974169 5:82095814-82095836 CAGCTTATCCCTAGGAGTAAAGG - Intronic
993926402 5:93871898-93871920 CTCCTTTCCCATAGGAAACATGG - Intronic
995749167 5:115436079-115436101 TTTTTTTCCCCTAGGAAAAAAGG - Intergenic
998360739 5:141584448-141584470 CTTTTTTTCTCTAAGAAAAATGG + Intronic
999456434 5:151720173-151720195 TTACTTTTCCCTAGGCAAAGGGG - Intergenic
999583251 5:153062827-153062849 CTGCTTTTCTTAAGCAAAAATGG - Intergenic
1000758524 5:165191139-165191161 CTACTTTTCTCTTGGTAAAAAGG - Intergenic
1000923067 5:167161310-167161332 CTGCTTCTCCCTAGGAAGTGGGG + Intergenic
1001147936 5:169201009-169201031 CTGCTTGTCCCTCCAAAAAAGGG - Intronic
1002912366 6:1499802-1499824 CTGCTTTTCAGAGGGAAAAAGGG - Intergenic
1006395531 6:33784701-33784723 CTGCCTTTCCCTTGGAATGACGG + Intronic
1007001896 6:38321281-38321303 CTGCCTTTCCCCAAGAAGAATGG - Intronic
1007273199 6:40653916-40653938 CAGCTTTCCCCTCTGAAAAATGG - Intergenic
1008176539 6:48274746-48274768 CTTCTTATCCATAGGAACAATGG + Intergenic
1008711830 6:54236954-54236976 CAGGTTTTCCCCAGGAGAAATGG + Intronic
1010463133 6:76135804-76135826 ATGCTTTTCCCTAGATAACAGGG - Intergenic
1010609223 6:77932687-77932709 CTGCTTCTTCCTATGTAAAATGG - Intergenic
1012995140 6:105965270-105965292 TTGCTTGTCCCAAGGAGAAATGG + Intergenic
1013814038 6:114076260-114076282 CTGTTTTTTCCTAGAAACAAAGG + Intronic
1014383416 6:120772607-120772629 GTGATGTTCCCTAGGAAAAGAGG + Intergenic
1014762932 6:125377787-125377809 CTGCTTTGCCCAAGAAGAAAGGG - Intergenic
1014819875 6:125975907-125975929 CTGCTTTTCCAAAGCAAAAGTGG + Intronic
1014909648 6:127076037-127076059 CTTCTTTTACCTATAAAAAAGGG - Intergenic
1015737581 6:136417193-136417215 CTGATTCTCACAAGGAAAAAGGG + Intronic
1016060787 6:139627691-139627713 TAGATTTTCCTTAGGAAAAATGG + Intergenic
1016712342 6:147188486-147188508 CTCATTTTGCCTAGGAAAAGGGG - Intergenic
1017949772 6:159126873-159126895 ATGCTTTTCTCTAGGCAGAAAGG - Intergenic
1018795976 6:167185986-167186008 CTGCATTTCCCTGCAAAAAAGGG - Intronic
1018820342 6:167369078-167369100 CTGCATTTCCCTGCAAAAAAGGG + Intronic
1018935990 6:168274315-168274337 CTGCCTTTCCCCAGGACACAAGG + Intergenic
1019393810 7:805693-805715 CTTCTTTTCCTTAGACAAAATGG - Intergenic
1020811512 7:12855164-12855186 TTACTTTTCCATAGGAAATAAGG - Intergenic
1022736528 7:33081360-33081382 CAGATTTTGCATAGGAAAAAGGG - Intergenic
1024704618 7:51943314-51943336 CAGCTTTTTCCTAGTAACAATGG - Intergenic
1024816557 7:53277750-53277772 CTGGTTTCCCCTAGGAGAAATGG - Intergenic
1029107137 7:98187207-98187229 CTGCTTTTCTAAAGGAAAATGGG - Intronic
1030029039 7:105352028-105352050 CTTATTTTCTCTAGGAAAATAGG - Intronic
1030197996 7:106871528-106871550 CTTCCGTTCCTTAGGAAAAAAGG + Intronic
1031583182 7:123502373-123502395 CTGGGTTTCCCTAAGAGAAAAGG + Intronic
1032191371 7:129767718-129767740 CTGCCTTTCCCTAGGATACATGG - Intergenic
1032255166 7:130291367-130291389 ATGATTTTCCCTGGGAGAAAAGG + Intergenic
1032676506 7:134134532-134134554 CTGCCTTCCCCAAGGAAAAATGG + Intronic
1032801942 7:135323965-135323987 CTGCTGTTCCTCAGGAAAGAAGG + Intergenic
1033920228 7:146381888-146381910 CTGATTTTCCCTGGGACAAATGG - Intronic
1036263555 8:7258124-7258146 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036264856 8:7265746-7265768 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036266157 8:7273368-7273390 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036267458 8:7280990-7281012 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036268760 8:7288612-7288634 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036270064 8:7296234-7296256 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036297832 8:7550821-7550843 CTGGTTTTCCCCAGGAGACAGGG + Intergenic
1036299136 8:7558469-7558491 CTGGTTTTCCCCAGGAGACAGGG + Intergenic
1036300441 8:7566119-7566141 CTGGTTTTCCCCAGGAGACAGGG + Intergenic
1036301744 8:7573763-7573785 CTGGTTTTCCCCAGGAGACAGGG + Intergenic
1036303041 8:7581412-7581434 CTGGTTTTCCCCAGGAGACAGGG + Intergenic
1036315596 8:7716663-7716685 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036316904 8:7724311-7724333 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036318211 8:7731959-7731981 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036319520 8:7739606-7739628 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036320827 8:7747254-7747276 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036322137 8:7754902-7754924 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036323446 8:7762550-7762572 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036324741 8:7770197-7770219 CTGGTTTTCCCCAGGAGACAGGG - Intergenic
1036351293 8:8014110-8014132 CTGGTTTTCCCCAGGAGACAGGG + Intergenic
1036352598 8:8021756-8021778 CTGGTTTTCCCCAGGAGACAGGG + Intergenic
1036353890 8:8029404-8029426 CTGGTTTTCCCCAGGAGACAGGG + Intergenic
1036818597 8:11920767-11920789 CAGCTTTTGCCTAGAAAAGAGGG + Intergenic
1036846560 8:12174529-12174551 CTGGTTTTCCCCAGGAGACAGGG + Intergenic
1036904591 8:12697236-12697258 CACCTTTTGCCTAGGAAAGAGGG + Intergenic
1037938735 8:22933192-22933214 CTGCTTTGCCTAAGGGAAAAGGG + Intronic
1038000338 8:23386037-23386059 CGGTTTTTCCTTAGGAAAATAGG - Intronic
1039559074 8:38498114-38498136 CTGCTTTTCCCTGGGCAAGTAGG - Intergenic
1041271287 8:56111705-56111727 CACATTTACCCTAGGAAAAAGGG - Intergenic
1042079045 8:65029872-65029894 TTGCCGTTCCCTAGGCAAAACGG - Intergenic
1042422766 8:68611354-68611376 CTGCATTTCTTTTGGAAAAAGGG + Intronic
1042904417 8:73758522-73758544 CTCCTTTTCTCTAGGCACAAAGG - Intronic
1043281524 8:78473123-78473145 CTGTATTTCCCTAGGAGCAATGG + Intergenic
1043485222 8:80692696-80692718 CTTCATTTACCTGGGAAAAAAGG + Intronic
1043685103 8:83074683-83074705 CTGCTTTTCCCTCTGAAAATAGG - Intergenic
1045257150 8:100535883-100535905 CTTCATTTCTCTAGGATAAATGG + Intronic
1045537763 8:103048448-103048470 GTGCTTTCCCTTAGGAAGAAAGG - Intronic
1045540389 8:103078779-103078801 CTGTATTTCCCCTGGAAAAACGG - Intergenic
1046127248 8:109925107-109925129 CTACTTTTTCCTAGTAAAGAGGG - Intergenic
1048024926 8:130577643-130577665 CTGCTTTTCAGTAGGTAAAAGGG + Intergenic
1048801873 8:138201654-138201676 CTGCTTTGTGCTAGGGAAAATGG - Intronic
1049073532 8:140375571-140375593 CTGCATATCCCTAAGAAACAGGG + Intronic
1049077122 8:140407399-140407421 CTTTTTTTCCCTTGGAGAAATGG + Intronic
1053109698 9:35447567-35447589 CTTTTTTTCCCTAAGAAACAAGG - Intergenic
1054929349 9:70619810-70619832 CTTCTTTCAGCTAGGAAAAATGG - Intronic
1054946302 9:70799513-70799535 CTCCTTTTCCAGAGGAAAGAAGG - Intronic
1058358240 9:104108178-104108200 TAACTTTTCCCTAGGAAAACTGG + Intronic
1059260450 9:112971049-112971071 CTGCTTTCCCAGAAGAAAAATGG - Intergenic
1060673009 9:125486825-125486847 CTGCTCTTCAGTAGGAAAACAGG - Intronic
1060887841 9:127168153-127168175 CTGCTGCACCCTAGGAAGAAAGG - Intronic
1185452424 X:289907-289929 CTGCTAGTCCCTGGGAAACAGGG + Intronic
1185877933 X:3714702-3714724 CTGCATTTCCCTGGGGAAAGGGG - Intergenic
1187281192 X:17859954-17859976 TTGCTTTTTCCTTGGAAAACTGG + Intronic
1188064408 X:25640572-25640594 TTTTTTTTCCCTAGGAAAATGGG + Intergenic
1188600061 X:31952726-31952748 CTGCTTTTCCCCATGAGAATGGG + Intronic
1189172425 X:38922599-38922621 GTTCTTATCCCTAGGAAAAGAGG + Intergenic
1191020159 X:55851036-55851058 CTGCTGTTACCCAGGAAAACAGG - Intergenic
1194092036 X:89589932-89589954 TTCCTTTTCCCTAAGAAGAATGG + Intergenic
1195119208 X:101733309-101733331 CTGCTTTTCTCTGAGAGAAAGGG + Intergenic
1196512097 X:116523840-116523862 CTGTTTTTCTCAAGCAAAAAGGG + Intergenic
1196676069 X:118421149-118421171 CTGCTTTGCTTTAGGGAAAAGGG + Intronic
1197573392 X:128178009-128178031 CTACATATCCCTAGGAAAGAGGG + Intergenic
1197999977 X:132423665-132423687 CTTTTTTTCATTAGGAAAAAAGG - Intronic
1198971878 X:142291103-142291125 CTGCATTTGCTTAGGAAAAAAGG - Intergenic
1200014002 X:153145261-153145283 CTTCTTCTCTCCAGGAAAAAGGG - Intergenic
1200025598 X:153254692-153254714 CTTCTTCTCTCCAGGAAAAAGGG + Intergenic
1200444668 Y:3245970-3245992 TTCCTTTTCCCTAAGAAGAATGG + Intergenic
1200678305 Y:6177241-6177263 CTGCTGTTACCCAGGAAAACAGG + Intergenic
1200787439 Y:7273092-7273114 CTGCATTTCCCTGGGGAAAGGGG + Intergenic