ID: 1119324288

View in Genome Browser
Species Human (GRCh38)
Location 14:73750468-73750490
Sequence CAGATACCCCCAGTCTGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 139}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119324288_1119324300 24 Left 1119324288 14:73750468-73750490 CCCCTCCAGACTGGGGGTATCTG 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1119324300 14:73750515-73750537 GCCCAAAGGGTGTTGAGGTATGG 0: 1
1: 0
2: 1
3: 4
4: 76
1119324288_1119324302 25 Left 1119324288 14:73750468-73750490 CCCCTCCAGACTGGGGGTATCTG 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1119324302 14:73750516-73750538 CCCAAAGGGTGTTGAGGTATGGG 0: 1
1: 0
2: 0
3: 7
4: 105
1119324288_1119324296 10 Left 1119324288 14:73750468-73750490 CCCCTCCAGACTGGGGGTATCTG 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1119324296 14:73750501-73750523 TGGAAGCCAAGAGAGCCCAAAGG 0: 1
1: 0
2: 0
3: 26
4: 365
1119324288_1119324292 -10 Left 1119324288 14:73750468-73750490 CCCCTCCAGACTGGGGGTATCTG 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1119324292 14:73750481-73750503 GGGGTATCTGTAAAAGCCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 111
1119324288_1119324299 19 Left 1119324288 14:73750468-73750490 CCCCTCCAGACTGGGGGTATCTG 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1119324299 14:73750510-73750532 AGAGAGCCCAAAGGGTGTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 175
1119324288_1119324304 26 Left 1119324288 14:73750468-73750490 CCCCTCCAGACTGGGGGTATCTG 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1119324304 14:73750517-73750539 CCAAAGGGTGTTGAGGTATGGGG 0: 1
1: 0
2: 1
3: 9
4: 130
1119324288_1119324305 27 Left 1119324288 14:73750468-73750490 CCCCTCCAGACTGGGGGTATCTG 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1119324305 14:73750518-73750540 CAAAGGGTGTTGAGGTATGGGGG 0: 1
1: 0
2: 2
3: 7
4: 203
1119324288_1119324297 11 Left 1119324288 14:73750468-73750490 CCCCTCCAGACTGGGGGTATCTG 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1119324297 14:73750502-73750524 GGAAGCCAAGAGAGCCCAAAGGG 0: 1
1: 0
2: 3
3: 29
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119324288 Original CRISPR CAGATACCCCCAGTCTGGAG GGG (reversed) Intronic