ID: 1119324291

View in Genome Browser
Species Human (GRCh38)
Location 14:73750473-73750495
Sequence TTTTACAGATACCCCCAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 92}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119324291_1119324304 21 Left 1119324291 14:73750473-73750495 CCAGACTGGGGGTATCTGTAAAA 0: 1
1: 0
2: 1
3: 15
4: 92
Right 1119324304 14:73750517-73750539 CCAAAGGGTGTTGAGGTATGGGG 0: 1
1: 0
2: 1
3: 9
4: 130
1119324291_1119324305 22 Left 1119324291 14:73750473-73750495 CCAGACTGGGGGTATCTGTAAAA 0: 1
1: 0
2: 1
3: 15
4: 92
Right 1119324305 14:73750518-73750540 CAAAGGGTGTTGAGGTATGGGGG 0: 1
1: 0
2: 2
3: 7
4: 203
1119324291_1119324297 6 Left 1119324291 14:73750473-73750495 CCAGACTGGGGGTATCTGTAAAA 0: 1
1: 0
2: 1
3: 15
4: 92
Right 1119324297 14:73750502-73750524 GGAAGCCAAGAGAGCCCAAAGGG 0: 1
1: 0
2: 3
3: 29
4: 269
1119324291_1119324302 20 Left 1119324291 14:73750473-73750495 CCAGACTGGGGGTATCTGTAAAA 0: 1
1: 0
2: 1
3: 15
4: 92
Right 1119324302 14:73750516-73750538 CCCAAAGGGTGTTGAGGTATGGG 0: 1
1: 0
2: 0
3: 7
4: 105
1119324291_1119324299 14 Left 1119324291 14:73750473-73750495 CCAGACTGGGGGTATCTGTAAAA 0: 1
1: 0
2: 1
3: 15
4: 92
Right 1119324299 14:73750510-73750532 AGAGAGCCCAAAGGGTGTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 175
1119324291_1119324296 5 Left 1119324291 14:73750473-73750495 CCAGACTGGGGGTATCTGTAAAA 0: 1
1: 0
2: 1
3: 15
4: 92
Right 1119324296 14:73750501-73750523 TGGAAGCCAAGAGAGCCCAAAGG 0: 1
1: 0
2: 0
3: 26
4: 365
1119324291_1119324300 19 Left 1119324291 14:73750473-73750495 CCAGACTGGGGGTATCTGTAAAA 0: 1
1: 0
2: 1
3: 15
4: 92
Right 1119324300 14:73750515-73750537 GCCCAAAGGGTGTTGAGGTATGG 0: 1
1: 0
2: 1
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119324291 Original CRISPR TTTTACAGATACCCCCAGTC TGG (reversed) Intronic