ID: 1119324294

View in Genome Browser
Species Human (GRCh38)
Location 14:73750498-73750520
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 199}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119324294_1119324302 -5 Left 1119324294 14:73750498-73750520 CCCTGGAAGCCAAGAGAGCCCAA 0: 1
1: 0
2: 1
3: 20
4: 199
Right 1119324302 14:73750516-73750538 CCCAAAGGGTGTTGAGGTATGGG 0: 1
1: 0
2: 0
3: 7
4: 105
1119324294_1119324304 -4 Left 1119324294 14:73750498-73750520 CCCTGGAAGCCAAGAGAGCCCAA 0: 1
1: 0
2: 1
3: 20
4: 199
Right 1119324304 14:73750517-73750539 CCAAAGGGTGTTGAGGTATGGGG 0: 1
1: 0
2: 1
3: 9
4: 130
1119324294_1119324305 -3 Left 1119324294 14:73750498-73750520 CCCTGGAAGCCAAGAGAGCCCAA 0: 1
1: 0
2: 1
3: 20
4: 199
Right 1119324305 14:73750518-73750540 CAAAGGGTGTTGAGGTATGGGGG 0: 1
1: 0
2: 2
3: 7
4: 203
1119324294_1119324306 7 Left 1119324294 14:73750498-73750520 CCCTGGAAGCCAAGAGAGCCCAA 0: 1
1: 0
2: 1
3: 20
4: 199
Right 1119324306 14:73750528-73750550 TGAGGTATGGGGGACTGCAGAGG 0: 1
1: 1
2: 1
3: 23
4: 252
1119324294_1119324308 18 Left 1119324294 14:73750498-73750520 CCCTGGAAGCCAAGAGAGCCCAA 0: 1
1: 0
2: 1
3: 20
4: 199
Right 1119324308 14:73750539-73750561 GGACTGCAGAGGTGAGCTGGAGG 0: 1
1: 2
2: 2
3: 44
4: 501
1119324294_1119324307 15 Left 1119324294 14:73750498-73750520 CCCTGGAAGCCAAGAGAGCCCAA 0: 1
1: 0
2: 1
3: 20
4: 199
Right 1119324307 14:73750536-73750558 GGGGGACTGCAGAGGTGAGCTGG 0: 1
1: 0
2: 3
3: 60
4: 496
1119324294_1119324309 25 Left 1119324294 14:73750498-73750520 CCCTGGAAGCCAAGAGAGCCCAA 0: 1
1: 0
2: 1
3: 20
4: 199
Right 1119324309 14:73750546-73750568 AGAGGTGAGCTGGAGGCTGCAGG 0: 1
1: 0
2: 4
3: 79
4: 538
1119324294_1119324300 -6 Left 1119324294 14:73750498-73750520 CCCTGGAAGCCAAGAGAGCCCAA 0: 1
1: 0
2: 1
3: 20
4: 199
Right 1119324300 14:73750515-73750537 GCCCAAAGGGTGTTGAGGTATGG 0: 1
1: 0
2: 1
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119324294 Original CRISPR TTGGGCTCTCTTGGCTTCCA GGG (reversed) Intronic