ID: 1119324298

View in Genome Browser
Species Human (GRCh38)
Location 14:73750507-73750529
Sequence CAACACCCTTTGGGCTCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 152}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119324298_1119324308 9 Left 1119324298 14:73750507-73750529 CCAAGAGAGCCCAAAGGGTGTTG 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1119324308 14:73750539-73750561 GGACTGCAGAGGTGAGCTGGAGG 0: 1
1: 2
2: 2
3: 44
4: 501
1119324298_1119324307 6 Left 1119324298 14:73750507-73750529 CCAAGAGAGCCCAAAGGGTGTTG 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1119324307 14:73750536-73750558 GGGGGACTGCAGAGGTGAGCTGG 0: 1
1: 0
2: 3
3: 60
4: 496
1119324298_1119324309 16 Left 1119324298 14:73750507-73750529 CCAAGAGAGCCCAAAGGGTGTTG 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1119324309 14:73750546-73750568 AGAGGTGAGCTGGAGGCTGCAGG 0: 1
1: 0
2: 4
3: 79
4: 538
1119324298_1119324306 -2 Left 1119324298 14:73750507-73750529 CCAAGAGAGCCCAAAGGGTGTTG 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1119324306 14:73750528-73750550 TGAGGTATGGGGGACTGCAGAGG 0: 1
1: 1
2: 1
3: 23
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119324298 Original CRISPR CAACACCCTTTGGGCTCTCT TGG (reversed) Intronic