ID: 1119324299

View in Genome Browser
Species Human (GRCh38)
Location 14:73750510-73750532
Sequence AGAGAGCCCAAAGGGTGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 175}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119324291_1119324299 14 Left 1119324291 14:73750473-73750495 CCAGACTGGGGGTATCTGTAAAA 0: 1
1: 0
2: 1
3: 15
4: 92
Right 1119324299 14:73750510-73750532 AGAGAGCCCAAAGGGTGTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 175
1119324288_1119324299 19 Left 1119324288 14:73750468-73750490 CCCCTCCAGACTGGGGGTATCTG 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1119324299 14:73750510-73750532 AGAGAGCCCAAAGGGTGTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 175
1119324289_1119324299 18 Left 1119324289 14:73750469-73750491 CCCTCCAGACTGGGGGTATCTGT 0: 1
1: 0
2: 0
3: 10
4: 121
Right 1119324299 14:73750510-73750532 AGAGAGCCCAAAGGGTGTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 175
1119324293_1119324299 -10 Left 1119324293 14:73750497-73750519 CCCCTGGAAGCCAAGAGAGCCCA 0: 1
1: 0
2: 1
3: 22
4: 276
Right 1119324299 14:73750510-73750532 AGAGAGCCCAAAGGGTGTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 175
1119324290_1119324299 17 Left 1119324290 14:73750470-73750492 CCTCCAGACTGGGGGTATCTGTA 0: 1
1: 0
2: 1
3: 7
4: 70
Right 1119324299 14:73750510-73750532 AGAGAGCCCAAAGGGTGTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119324299 Original CRISPR AGAGAGCCCAAAGGGTGTTG AGG Intronic