ID: 1119324302

View in Genome Browser
Species Human (GRCh38)
Location 14:73750516-73750538
Sequence CCCAAAGGGTGTTGAGGTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 105}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119324288_1119324302 25 Left 1119324288 14:73750468-73750490 CCCCTCCAGACTGGGGGTATCTG 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1119324302 14:73750516-73750538 CCCAAAGGGTGTTGAGGTATGGG 0: 1
1: 0
2: 0
3: 7
4: 105
1119324291_1119324302 20 Left 1119324291 14:73750473-73750495 CCAGACTGGGGGTATCTGTAAAA 0: 1
1: 0
2: 1
3: 15
4: 92
Right 1119324302 14:73750516-73750538 CCCAAAGGGTGTTGAGGTATGGG 0: 1
1: 0
2: 0
3: 7
4: 105
1119324293_1119324302 -4 Left 1119324293 14:73750497-73750519 CCCCTGGAAGCCAAGAGAGCCCA 0: 1
1: 0
2: 1
3: 22
4: 276
Right 1119324302 14:73750516-73750538 CCCAAAGGGTGTTGAGGTATGGG 0: 1
1: 0
2: 0
3: 7
4: 105
1119324289_1119324302 24 Left 1119324289 14:73750469-73750491 CCCTCCAGACTGGGGGTATCTGT 0: 1
1: 0
2: 0
3: 10
4: 121
Right 1119324302 14:73750516-73750538 CCCAAAGGGTGTTGAGGTATGGG 0: 1
1: 0
2: 0
3: 7
4: 105
1119324290_1119324302 23 Left 1119324290 14:73750470-73750492 CCTCCAGACTGGGGGTATCTGTA 0: 1
1: 0
2: 1
3: 7
4: 70
Right 1119324302 14:73750516-73750538 CCCAAAGGGTGTTGAGGTATGGG 0: 1
1: 0
2: 0
3: 7
4: 105
1119324294_1119324302 -5 Left 1119324294 14:73750498-73750520 CCCTGGAAGCCAAGAGAGCCCAA 0: 1
1: 0
2: 1
3: 20
4: 199
Right 1119324302 14:73750516-73750538 CCCAAAGGGTGTTGAGGTATGGG 0: 1
1: 0
2: 0
3: 7
4: 105
1119324295_1119324302 -6 Left 1119324295 14:73750499-73750521 CCTGGAAGCCAAGAGAGCCCAAA 0: 1
1: 0
2: 1
3: 27
4: 274
Right 1119324302 14:73750516-73750538 CCCAAAGGGTGTTGAGGTATGGG 0: 1
1: 0
2: 0
3: 7
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119324302 Original CRISPR CCCAAAGGGTGTTGAGGTAT GGG Intronic