ID: 1119324306

View in Genome Browser
Species Human (GRCh38)
Location 14:73750528-73750550
Sequence TGAGGTATGGGGGACTGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 252}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119324293_1119324306 8 Left 1119324293 14:73750497-73750519 CCCCTGGAAGCCAAGAGAGCCCA 0: 1
1: 0
2: 1
3: 22
4: 276
Right 1119324306 14:73750528-73750550 TGAGGTATGGGGGACTGCAGAGG 0: 1
1: 1
2: 1
3: 23
4: 252
1119324294_1119324306 7 Left 1119324294 14:73750498-73750520 CCCTGGAAGCCAAGAGAGCCCAA 0: 1
1: 0
2: 1
3: 20
4: 199
Right 1119324306 14:73750528-73750550 TGAGGTATGGGGGACTGCAGAGG 0: 1
1: 1
2: 1
3: 23
4: 252
1119324295_1119324306 6 Left 1119324295 14:73750499-73750521 CCTGGAAGCCAAGAGAGCCCAAA 0: 1
1: 0
2: 1
3: 27
4: 274
Right 1119324306 14:73750528-73750550 TGAGGTATGGGGGACTGCAGAGG 0: 1
1: 1
2: 1
3: 23
4: 252
1119324298_1119324306 -2 Left 1119324298 14:73750507-73750529 CCAAGAGAGCCCAAAGGGTGTTG 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1119324306 14:73750528-73750550 TGAGGTATGGGGGACTGCAGAGG 0: 1
1: 1
2: 1
3: 23
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119324306 Original CRISPR TGAGGTATGGGGGACTGCAG AGG Intronic