ID: 1119324308

View in Genome Browser
Species Human (GRCh38)
Location 14:73750539-73750561
Sequence GGACTGCAGAGGTGAGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 550
Summary {0: 1, 1: 2, 2: 2, 3: 44, 4: 501}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119324295_1119324308 17 Left 1119324295 14:73750499-73750521 CCTGGAAGCCAAGAGAGCCCAAA 0: 1
1: 0
2: 1
3: 27
4: 274
Right 1119324308 14:73750539-73750561 GGACTGCAGAGGTGAGCTGGAGG 0: 1
1: 2
2: 2
3: 44
4: 501
1119324298_1119324308 9 Left 1119324298 14:73750507-73750529 CCAAGAGAGCCCAAAGGGTGTTG 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1119324308 14:73750539-73750561 GGACTGCAGAGGTGAGCTGGAGG 0: 1
1: 2
2: 2
3: 44
4: 501
1119324293_1119324308 19 Left 1119324293 14:73750497-73750519 CCCCTGGAAGCCAAGAGAGCCCA 0: 1
1: 0
2: 1
3: 22
4: 276
Right 1119324308 14:73750539-73750561 GGACTGCAGAGGTGAGCTGGAGG 0: 1
1: 2
2: 2
3: 44
4: 501
1119324294_1119324308 18 Left 1119324294 14:73750498-73750520 CCCTGGAAGCCAAGAGAGCCCAA 0: 1
1: 0
2: 1
3: 20
4: 199
Right 1119324308 14:73750539-73750561 GGACTGCAGAGGTGAGCTGGAGG 0: 1
1: 2
2: 2
3: 44
4: 501
1119324301_1119324308 0 Left 1119324301 14:73750516-73750538 CCCAAAGGGTGTTGAGGTATGGG 0: 1
1: 0
2: 1
3: 9
4: 99
Right 1119324308 14:73750539-73750561 GGACTGCAGAGGTGAGCTGGAGG 0: 1
1: 2
2: 2
3: 44
4: 501
1119324303_1119324308 -1 Left 1119324303 14:73750517-73750539 CCAAAGGGTGTTGAGGTATGGGG 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1119324308 14:73750539-73750561 GGACTGCAGAGGTGAGCTGGAGG 0: 1
1: 2
2: 2
3: 44
4: 501

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119324308 Original CRISPR GGACTGCAGAGGTGAGCTGG AGG Intronic