ID: 1119325275

View in Genome Browser
Species Human (GRCh38)
Location 14:73756296-73756318
Sequence GCGCGCGCGCGTGCGCGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 2, 2: 9, 3: 63, 4: 297}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119325274_1119325275 13 Left 1119325274 14:73756260-73756282 CCATGTCAGTGTGTGTGTGTGTG 0: 3
1: 46
2: 2131
3: 3370
4: 5732
Right 1119325275 14:73756296-73756318 GCGCGCGCGCGTGCGCGCTGAGG 0: 1
1: 2
2: 9
3: 63
4: 297
1119325273_1119325275 14 Left 1119325273 14:73756259-73756281 CCCATGTCAGTGTGTGTGTGTGT 0: 2
1: 10
2: 241
3: 4046
4: 6184
Right 1119325275 14:73756296-73756318 GCGCGCGCGCGTGCGCGCTGAGG 0: 1
1: 2
2: 9
3: 63
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119325275 Original CRISPR GCGCGCGCGCGTGCGCGCTG AGG Intronic
900100246 1:959405-959427 GCGCGTTCGCGTGCTCGGTGCGG + Intergenic
901660147 1:10794197-10794219 GTGCGCGCGCGCGCGCGTCGTGG + Intronic
902348428 1:15835918-15835940 GCGCGCGCGCGCTCGCCGTGCGG + Intergenic
902585740 1:17437965-17437987 GCGCGCGCCCGGGCCCGCGGCGG - Intronic
902586229 1:17439916-17439938 GCGGGCCCGCGAGCGCGCTTTGG + Intergenic
903795119 1:25922921-25922943 GCGCGGCCGCGTGCGCCCGGGGG - Intergenic
904563389 1:31413316-31413338 GCGCGCGCGGGCGGGCGCCGGGG - Intronic
904847475 1:33430948-33430970 GGGCGGGCGCGTGCGCGCTGGGG - Intronic
907526478 1:55056865-55056887 GCGTGCGCGCGCGCGCGTTGGGG + Intronic
907526482 1:55056871-55056893 GCGCGCGCGCGTTGGGGGTGGGG + Intronic
908014119 1:59814525-59814547 GCGAGCGCGCGTGCGCGGCGGGG - Intergenic
908501105 1:64744891-64744913 GCGGGCGCGCCTGTGCGCCGGGG + Intergenic
910533951 1:88275030-88275052 GCGCGCGCGCGCGCGCGCCTGGG + Intergenic
912684243 1:111749444-111749466 GTGCGCGCGCGCGCGTGCTAGGG + Intronic
913323517 1:117606607-117606629 GCGCGCCCGCGGGAGCGCCGGGG - Intronic
914393449 1:147242614-147242636 GGGCGCGCGACTGCGCGCTGGGG - Intronic
914869118 1:151458807-151458829 GAGTGCGCGCGCGCGCGCCGCGG + Intronic
917141636 1:171841462-171841484 CCGCCCGCGCAGGCGCGCTGCGG + Intergenic
917565382 1:176207269-176207291 GTGCGCGCGCGCGCGAGCGGCGG + Exonic
920600599 1:207320870-207320892 GCGCGCGCGCGCGCGCCTCGGGG - Intergenic
920600601 1:207320872-207320894 GCGCGCGCGCGCGCGCGCCTCGG - Intergenic
921357882 1:214303782-214303804 GGGCGGGGGCGTGCGCGGTGGGG - Intronic
922831531 1:228556784-228556806 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922832009 1:228608738-228608760 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922832570 1:228610979-228611001 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922833130 1:228613220-228613242 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922833691 1:228615461-228615483 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922834250 1:228617702-228617724 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922835359 1:228622158-228622180 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922835918 1:228624378-228624400 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922836477 1:228626620-228626642 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922837035 1:228628859-228628881 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922837594 1:228631101-228631123 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922838153 1:228633342-228633364 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922838712 1:228635581-228635603 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922839270 1:228637807-228637829 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922840392 1:228642279-228642301 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922958556 1:229625813-229625835 GCGCGCGCGCGGGCGGGCGGGGG - Intronic
923191709 1:231626668-231626690 GCGCGCGCGCGCGCGCGTCAGGG + Intronic
1064167770 10:13001505-13001527 GCAGGCGCGCGCGGGCGCTGGGG + Exonic
1065099904 10:22321890-22321912 GCGCGCTCGCGGGCGCGGGGAGG - Intronic
1065214701 10:23438881-23438903 CCGCGCGCGCTCGCGCGCCGAGG + Intergenic
1067060854 10:43077241-43077263 GCCATCGCCCGTGCGCGCTGGGG - Exonic
1067091155 10:43266502-43266524 GCGGGCGGGCGTGGGCACTGCGG - Intronic
1069651684 10:70053655-70053677 GCGGGCGGGCGTGCGCCCCGGGG + Intronic
1069913498 10:71773523-71773545 GTGCGAGCGAGTGAGCGCTGCGG + Intronic
1070796752 10:79221411-79221433 GCCCGCGCACGTGCGCTCTGAGG - Intronic
1072994194 10:100228970-100228992 GCGCGCGCGCGCGCGCTTGGAGG - Intronic
1073147958 10:101292629-101292651 GCGCGCGTGCGTGTGCGCGGCGG - Intergenic
1073864997 10:107792299-107792321 GCGCGCGCGCGTACCCTTTGTGG + Intergenic
1074810204 10:117096994-117097016 GTGCGCGCGCGTGCGCGCTTGGG - Intronic
1075748462 10:124744097-124744119 GCAGGCGAGCGTGCGCGCGGCGG - Intronic
1076371748 10:129959808-129959830 GCGCGGGCTCGGGCGCCCTGGGG - Intronic
1076878960 10:133230804-133230826 GAGCCGGCGCGTGCGCGTTGGGG - Exonic
1076930327 10:133528055-133528077 GCTCTTGCGCGTGCGCTCTGTGG + Intronic
1077038638 11:507489-507511 GCGGGCGCGTGTGCGTGTTGTGG + Intergenic
1077124325 11:925747-925769 GCGCGCGCGCGTCCGCGGCACGG - Intronic
1077281619 11:1748632-1748654 GCGCCCGCGGGTGCGCCCCGGGG - Intronic
1078988026 11:16613594-16613616 GCGCGCGCGCGTGGAGGCAGCGG - Intronic
1082035554 11:47642567-47642589 GCGTGCGTGCGCGCGCGCCGCGG - Exonic
1082035579 11:47642649-47642671 GCGCTCGCGAGGGGGCGCTGAGG + Intergenic
1083933377 11:65857921-65857943 GTGCGCGCCCGTGGGCGCCGGGG - Intronic
1084112549 11:67023382-67023404 GCGCAGGTGCGTGCGCGCTGCGG + Intronic
1084265729 11:68004201-68004223 GCGCGCGCGCGTGTGTGCAGGGG + Intronic
1087141439 11:94768887-94768909 GCGCGGGCGCGGGCGCGCCTCGG - Intronic
1088820483 11:113452472-113452494 GCGCGCGCGCGCGCGCACATTGG + Intronic
1088820485 11:113452474-113452496 GCGCGCGCGCGCGCACATTGGGG + Intronic
1089977444 11:122744897-122744919 GTGCGCGCGCGCGCGCACTTGGG + Intronic
1090788364 11:130069622-130069644 GCGCGGGGGCGTGCGCGCGGCGG - Intergenic
1091720930 12:2812945-2812967 GAGCGTGAGCATGCGCGCTGTGG + Intronic
1091778471 12:3199723-3199745 GCGCCCGTGCGTGCGCGCCGAGG + Intronic
1092655044 12:10674872-10674894 GTGCGCGCGCGCGCGCGCGCGGG - Intergenic
1095180861 12:39145228-39145250 GGGCGCGCGCTTTCGCGCCGGGG - Intergenic
1096101296 12:48971832-48971854 GCGCGCGCGCGCGCGCTGGGAGG - Intergenic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1096254956 12:50057347-50057369 GCGCGCGCGTGTGTGCGCGCAGG - Intergenic
1096435932 12:51591160-51591182 GCGCGCGCGGTGGCGCGCGGCGG + Intronic
1096994616 12:55830810-55830832 GCGCGCGCGTGCGCGCGGTGGGG - Intronic
1096994618 12:55830812-55830834 GCGCGCGCGCGTGCGCGCGGTGG - Intronic
1098350782 12:69557618-69557640 GTGCGCGCGCGCGCGCGCGCAGG + Intronic
1099989784 12:89709397-89709419 GTGCGCGCGCGCGCGCGCGGAGG + Intergenic
1100985660 12:100199844-100199866 GCCCCCGCGCCTTCGCGCTGCGG + Intronic
1101354718 12:103966121-103966143 GCGCGCGCGCGCGCACGCAGGGG + Intronic
1101354729 12:103966175-103966197 GGGGCCGCGCGTGCGCACTGTGG + Intronic
1101910598 12:108857743-108857765 GCGCGTGCGCGGGGGCCCTGAGG + Intergenic
1101966307 12:109284571-109284593 GCGTGTGTGTGTGCGCGCTGTGG + Intronic
1102084395 12:110124283-110124305 GCGCGCGCGCGCACGAGCTGGGG - Intergenic
1103348348 12:120265742-120265764 GCGGGCGCGGGCGCGCGCGGCGG - Exonic
1103764368 12:123270814-123270836 GCGCGCGGGCGTGGGGGCAGTGG - Intronic
1104568285 12:129903899-129903921 GCTCGGGCGCGCGCGCGCTCCGG + Intergenic
1104602641 12:130163464-130163486 GCGGGTGCTCCTGCGCGCTGTGG - Exonic
1110922491 13:81106116-81106138 GTGTGCGCGCGTGCGCGCACAGG - Intergenic
1112216244 13:97434075-97434097 GGGCGCGCGCTCGAGCGCTGGGG + Intergenic
1112507041 13:99981603-99981625 GCGCGCGCGGGTGCGCGCAGGGG + Intergenic
1113517387 13:110914378-110914400 GCGCGCGCGCGCGCTCGCACAGG + Intronic
1117721910 14:58637226-58637248 GTGCGCGCGCGTGCGCGCTTTGG - Intronic
1118323159 14:64765042-64765064 GCGCGCGCGCGCGCGGGTGGTGG + Intronic
1118827557 14:69398004-69398026 GCGCGCCCGCCTGCTCGCTCGGG - Intronic
1118925494 14:70187641-70187663 CCGCGCGCGCGTGTGTGTTGGGG + Intronic
1119325275 14:73756296-73756318 GCGCGCGCGCGTGCGCGCTGAGG + Intronic
1121101557 14:91253532-91253554 GCGCGTGCGCGTGCGAGGCGGGG - Intronic
1121461385 14:94081227-94081249 GCACGTACTCGTGCGCGCTGGGG + Exonic
1122220968 14:100239031-100239053 GCGCGGGCGCGGGCGCACCGAGG + Exonic
1122265916 14:100546761-100546783 GTGCGCGCGCGCGCGCGCGCCGG - Intronic
1122688615 14:103521485-103521507 GGGCGGGCGGGTCCGCGCTGCGG - Intronic
1123653423 15:22494627-22494649 GCGGGAGCGCGTGCGTGCGGCGG + Intergenic
1124014220 15:25862612-25862634 GCGGGCGAGCGAGCGCGCGGTGG - Intronic
1124109527 15:26773150-26773172 GAGCGCGCGCGGGCGCGGGGCGG + Intronic
1124696929 15:31870935-31870957 GCGCGCCCGCGAGCCCGCTCCGG + Intergenic
1125201017 15:37100746-37100768 GCGCGCGCGCGCGCGCGAACAGG + Intronic
1125270535 15:37934101-37934123 GCGCGCGCGCGTGTGTGTAGGGG - Intronic
1126766478 15:52016049-52016071 GCGCGCGCGCGCGCGCGCGATGG - Intronic
1126800838 15:52295475-52295497 GGGCGGGCGGGCGCGCGCTGGGG - Intronic
1127415135 15:58749925-58749947 GGGCGCGCGCATGCGCGCGGGGG + Exonic
1127931643 15:63600986-63601008 GCGGGCGCGCGCGGGCGCGGGGG - Intronic
1127931647 15:63600991-63601013 GCGCCCGCGCGCGCCCGCCGCGG + Intronic
1128793197 15:70448085-70448107 TCACGCGAGCGAGCGCGCTGTGG + Intergenic
1129082340 15:73052267-73052289 GCGTGCGCGTGTGCGCGCCCGGG + Intronic
1129334276 15:74843123-74843145 GCGCGGGCGCTTCCTCGCTGCGG + Exonic
1129351228 15:74956916-74956938 GCGTGGGAGCGGGCGCGCTGCGG + Exonic
1129823763 15:78621020-78621042 GCGGGCGGGCGTGCGCGGGGCGG + Exonic
1130225318 15:82052938-82052960 GCGCGCGTGCGCGCGCAGTGAGG - Intergenic
1132055239 15:98647455-98647477 GCCGGGGCGCGTGCACGCTGCGG - Intergenic
1132055548 15:98648510-98648532 TCGCGCGCGCGCGCGCGCCCTGG - Intergenic
1132522305 16:397381-397403 GTGCGCGCACGTGCGGGCTGGGG + Intronic
1132683266 16:1152529-1152551 CCGCGCGCGCGTGTGTGATGGGG - Intergenic
1132983769 16:2752943-2752965 TCGAGCGCGCGTGCGCGCGGAGG - Intronic
1133029622 16:3004274-3004296 GCGCGGGCGCGGGCGAGCCGCGG - Intergenic
1133188485 16:4116476-4116498 CGGGCCGCGCGTGCGCGCTGCGG - Intergenic
1136399833 16:30011251-30011273 GCACGGGCGTGTGCGCGCGGGGG - Intronic
1136705992 16:32188324-32188346 GCGGGCGTGCGTGCGTGCCGCGG - Intergenic
1136761920 16:32741081-32741103 GCGGGCGTGCGTGCGTGCCGCGG + Intergenic
1136806180 16:33129307-33129329 GCGGGCGTGCGTGCGTGCCGCGG - Intergenic
1137261234 16:46831379-46831401 GCGAGCTCGCGGGCGGGCTGTGG - Exonic
1138956860 16:61981682-61981704 GCGCGCGCGCGCGTGCGCTTGGG + Intronic
1140219882 16:73036103-73036125 GCGCGCACGCGTGTGCTGTGTGG - Intronic
1140462244 16:75148959-75148981 CCGCGCGCGCGCGCCCGCCGGGG - Intronic
1141831097 16:86510367-86510389 GCGCGGGGGCGGGCGCGCCGCGG + Intergenic
1141989588 16:87602467-87602489 GCGCGCGGGCGGGCGGGGTGCGG + Intronic
1203064079 16_KI270728v1_random:1001397-1001419 GCGGGCGTGCGTGCGTGCCGCGG + Intergenic
1142672050 17:1491831-1491853 GGGCGCGCGCGTGTTCGCTGTGG - Intronic
1144840484 17:18183034-18183056 GCGAGCGTGGGGGCGCGCTGGGG - Intergenic
1145970188 17:28951580-28951602 GCCAGCGCGGCTGCGCGCTGGGG - Exonic
1146601966 17:34225229-34225251 GCGCGCGTGCGCGCGTGTTGGGG - Intergenic
1146922389 17:36722424-36722446 CGGCGAGCGCATGCGCGCTGGGG - Intergenic
1147440332 17:40443661-40443683 GCGGGCGCGCGGGCGAGCGGCGG - Exonic
1147731913 17:42609423-42609445 GCCTGCGCGCAAGCGCGCTGTGG - Intronic
1147742747 17:42678130-42678152 ACGCGCGCGCGCGCCCGCGGAGG - Intergenic
1148225150 17:45894282-45894304 CGGAACGCGCGTGCGCGCTGCGG + Intergenic
1148271728 17:46266919-46266941 GCGCGCGCGCGGCCGGGCGGCGG - Intergenic
1148284060 17:46372681-46372703 GAGCCCGCGCGCGCGCCCTGTGG + Intergenic
1148306281 17:46590602-46590624 GAGCCCGCGCGCGCGCCCTGTGG + Intergenic
1149677248 17:58477015-58477037 GCGCCCGCGCGTGTGCCGTGAGG - Intronic
1149994772 17:61400600-61400622 GCGGGCGGGCGGGCGGGCTGGGG + Intronic
1150643392 17:66964406-66964428 GAGCGCGCGCGGGCGCGGGGAGG + Intergenic
1151543324 17:74776478-74776500 GGGCCGGCGCATGCGCGCTGCGG + Exonic
1152697319 17:81803766-81803788 GCGCGCGGGCGTGGGGGCCGTGG - Intergenic
1160204516 18:76822321-76822343 GCGCGGGCGCGGGCGCGGTGGGG - Intergenic
1160500714 18:79400127-79400149 GCGCGCGCGCGAGGGGGCGGGGG + Intronic
1160763695 19:797929-797951 GCGGCCGCGCACGCGCGCTGGGG - Intronic
1160795031 19:941242-941264 GCGTGCGAGTGTGCACGCTGGGG + Intronic
1160930742 19:1568418-1568440 CCCCGCGCGCCTGCGCCCTGGGG - Intergenic
1160937813 19:1605475-1605497 CCCCGCGCGCGTGCGCGCCGCGG - Exonic
1160967550 19:1753311-1753333 GCGCCCGCCCGCGCCCGCTGGGG - Exonic
1161051290 19:2165115-2165137 GGGCGCGTGCGTCCGCGCTTGGG + Intronic
1161572001 19:5035887-5035909 GCGCGCGCGCCTGCGCGCACAGG + Intronic
1161643070 19:5436362-5436384 GCGCGCGCGCGCGTGCGGGGAGG + Intergenic
1161643072 19:5436364-5436386 GCGCGCGCGCGTGCGGGGAGGGG + Intergenic
1161707238 19:5827853-5827875 CGGCGCGCGCGTGCGCGGTTGGG + Exonic
1161802587 19:6424406-6424428 GCGCGCTCGCGCGCGCGCGCAGG - Intronic
1162361248 19:10221781-10221803 GCGCGCGCGCGTGTGCACATAGG - Intronic
1164648138 19:29873750-29873772 GCGCGGGCGCGGGGGCGCGGGGG - Intergenic
1165696730 19:37906694-37906716 GCGCGCGCGCGTTCTCGCGCCGG - Intergenic
1165928475 19:39342059-39342081 GCGCGCGAGCCTGCCCCCTGCGG + Intronic
1166304194 19:41928393-41928415 GCGCGGGCGGGCGCGCGCCGGGG + Intronic
1166330640 19:42076289-42076311 GAGCGCGAGCGGGCGCGCAGAGG + Intronic
1166347787 19:42177072-42177094 GCGGGCGCGCAGGCGAGCTGGGG + Intronic
1166555831 19:43699452-43699474 AGGCGCGCGCGTGTGCGCTTGGG + Intergenic
1166802585 19:45467640-45467662 GCGCGCGCGCGAGCGAGCGAGGG + Intronic
1166975052 19:46601104-46601126 GCGAGCGCGCGCGCGCCCGGCGG + Intronic
1168408021 19:56120862-56120884 GGGCGCGCGCGTGCGCGTGGCGG - Intronic
926020182 2:9487834-9487856 GCGCGCGCGCGCGCGCGCTGTGG + Intronic
926020184 2:9487836-9487858 GCGCGCGCGCGCGCGCTGTGGGG + Intronic
928093588 2:28391115-28391137 ACGCGCGCGCGTGCGCGACGAGG - Intergenic
928420884 2:31137482-31137504 CCGCGCGCGCCTGTGCGTTGCGG - Intronic
929974126 2:46616051-46616073 GCGCGCGCGCGCGTGGGCGGAGG + Intronic
929974128 2:46616053-46616075 GCGCGCGCGCGTGGGCGGAGGGG + Intronic
930096396 2:47570114-47570136 GCGGAGGCGCGGGCGCGCTGGGG - Exonic
931649374 2:64454398-64454420 GGGCGCGCGCGCGCGCGCCCGGG - Exonic
931867127 2:66425559-66425581 GCGCGCGCGCGCGCGCGTTCCGG - Intergenic
932355932 2:71068535-71068557 GCGCGTGCGCATGCGCGGGGCGG - Exonic
935645262 2:105329490-105329512 GAGCCCGTGCGTGTGCGCTGGGG - Intronic
936038143 2:109128963-109128985 GTGCGCGGGGGTGCGCGCGGAGG - Intergenic
937883736 2:126886479-126886501 GCGCACGCGAGGGGGCGCTGTGG - Intergenic
938302960 2:130229192-130229214 GCGCGTTCGCGTGCTCGGTGCGG - Intergenic
938414583 2:131093561-131093583 GCGCGAGCGCGAGCGCGGAGTGG + Intergenic
938453706 2:131445030-131445052 GCGCGTTCGCGTGCTCGGTGCGG + Intergenic
939153805 2:138501759-138501781 GCGAGGGCGCGTGCGCGCGGCGG - Intergenic
941686918 2:168456649-168456671 GCGCGCGTGTGTGTGCGCAGGGG - Intronic
942034728 2:171999843-171999865 GGGAGCGCGCGTGCGCGCGCGGG - Exonic
943589911 2:189784479-189784501 GCGCGCGTGCGTGCTGGGTGCGG + Exonic
945033357 2:205684937-205684959 GTGTGCGCGCTCGCGCGCTGGGG - Intronic
946422004 2:219570578-219570600 GCGCGTGGCCGTGCGCGTTGCGG + Exonic
1170226314 20:13995361-13995383 GCGCCTGCGCGTGCGCCCTGGGG + Exonic
1171963725 20:31514400-31514422 GTGTGCGCGCGTGCGCGGCGCGG + Intergenic
1172489224 20:35321286-35321308 GCGCGCGCGCGCGCACGCTCAGG + Intronic
1173488412 20:43458294-43458316 GCGCGCGCACGTGCGCGTCCTGG + Intronic
1173807494 20:45935192-45935214 GTGCGCGCGCGCGCGCGCGCTGG + Intronic
1174467867 20:50731432-50731454 GCGCGCGCGCGGGCTCGCGGGGG + Intergenic
1175911502 20:62407312-62407334 GCGCGCGGGCGCGCGGGCAGGGG - Intergenic
1176194569 20:63831293-63831315 GCGCGCGCGCGCGGGCGGCGGGG - Intergenic
1176194571 20:63831295-63831317 GGGCGCGCGCGCGCGGGCGGCGG - Intergenic
1176550496 21:8218949-8218971 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1176569424 21:8401986-8402008 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1176569426 21:8401988-8402010 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1176577338 21:8446219-8446241 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1177077013 21:16588646-16588668 GTGCGCGCGCGTGCTCGCTCGGG + Intergenic
1179225086 21:39445829-39445851 GGGCGCGCGCATGCGCACTCGGG + Intergenic
1180699660 22:17774399-17774421 GCGCGGGCGCGTCCGGGCCGAGG + Intronic
1181413296 22:22740185-22740207 GCGCGTGCGCGCGCGCTCTTTGG - Intronic
1181572020 22:23772891-23772913 GGGCGCGCGCGGCCGCGCTGCGG - Exonic
1181574892 22:23787365-23787387 GGGCGCGCGCGCGCGCGCTCGGG + Intronic
1182149504 22:28018287-28018309 GCGCGCGTGTGTGCGCGCGCGGG + Intronic
1182586298 22:31346016-31346038 GCGCGCGCGCGCCTGCGCGGCGG - Exonic
1182586300 22:31346023-31346045 GCAGGCGCGCGCGCGCGCCGCGG + Exonic
1182709617 22:32312344-32312366 GCGCGCGCGCGTGTGATTTGGGG - Intergenic
1183386868 22:37519738-37519760 CCGCACGGGCGGGCGCGCTGTGG - Intergenic
1183524848 22:38317032-38317054 ACACACGCGCGTTCGCGCTGGGG - Intronic
1183607120 22:38872304-38872326 GCGCGCTCGCGTTCCAGCTGCGG + Exonic
1183683639 22:39349804-39349826 GCGCGGGGGCGCGCGTGCTGCGG - Intergenic
1183702386 22:39457683-39457705 GGGCGGGCGCGGGCGCACTGGGG + Intronic
1184893273 22:47392234-47392256 GAGCGCGTGCGTGCGTGGTGTGG - Intergenic
1185302540 22:50090029-50090051 GCGCGGGCGCGTGCGGGCGGCGG + Exonic
1203255393 22_KI270733v1_random:135290-135312 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
950316434 3:12005078-12005100 GCGCGCGCGTTTGCGGGGTGAGG + Intronic
952316865 3:32238982-32239004 GTGTGCGAGCGGGCGCGCTGCGG - Exonic
953748697 3:45594040-45594062 GCGCGCGGGCGGGCGCCCAGGGG - Intronic
953925398 3:46980022-46980044 GCGCGCGGGCGCGCGCGCGCAGG + Intronic
956129272 3:66038907-66038929 ACGCGCGCGCATGCGCCCCGCGG + Intergenic
956179085 3:66500924-66500946 GCGCGCGCGCGCGCGCTCTCTGG - Exonic
956681450 3:71785258-71785280 GCGGGCGCGCGTGTGCGCGTGGG - Intergenic
960465934 3:117996885-117996907 GCGCGCGCGCGTGTGAACGGGGG - Intergenic
962263113 3:133927527-133927549 GCGTGCGTGCGTGCGTGCGGTGG + Intergenic
963236720 3:142963603-142963625 GCGCGCGGCCGCCCGCGCTGCGG + Exonic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
966182223 3:177197634-177197656 GCGGGCGGGCGGGCGCGCGGGGG + Intergenic
966220655 3:177547886-177547908 GCGCGCGCGTGTGTGTGTTGTGG + Intergenic
969330323 4:6470946-6470968 GCGCGGGCGCGGGCGGGCTCGGG - Intronic
970593186 4:17577177-17577199 GCGCCCGCGCATGCGGGCGGGGG - Exonic
971196182 4:24472892-24472914 GGGCGGGCGTGTGCGCGCGGGGG + Intergenic
974700862 4:65443941-65443963 GCACGCGCACATGCGCACTGGGG + Intronic
976897466 4:90128515-90128537 GTGCGCGCGCGCGCGCGCTCTGG + Intronic
977908463 4:102502367-102502389 GCGCGCGCGCGCGCACGGAGGGG - Intronic
977908465 4:102502369-102502391 GCGCGCGCGCGCGCGCACGGAGG - Intronic
978645785 4:110929711-110929733 GCGCGCGCGCGTGTACACTCAGG + Intergenic
979455642 4:120922853-120922875 GGGCGCGGGCCTGGGCGCTGCGG + Intronic
979469020 4:121072675-121072697 GCGTGCGCGCTGGCGCGCAGCGG - Intronic
980130039 4:128809869-128809891 GCCCGCGCGCGTACCTGCTGCGG - Exonic
981604016 4:146522819-146522841 GGGCGCGCGGGTGCCCGCTCTGG + Intergenic
982000303 4:151015750-151015772 GCGAGCGCGAGTGCGCGGGGCGG + Intergenic
983672166 4:170250617-170250639 GTGTGTGCGCGTGCGAGCTGTGG + Intergenic
984167437 4:176319869-176319891 GCGCCGCCCCGTGCGCGCTGTGG + Intergenic
985549178 5:524518-524540 GCGCTCGCGAGTGCGCGGCGGGG - Intergenic
986976046 5:13395291-13395313 GCGCGCGCGCACGCGCGCACTGG - Intergenic
987303420 5:16617006-16617028 GCGCGCGCGCGGGCGCGCCTGGG + Exonic
987901086 5:24013048-24013070 GTGCGCGCGCGCGCAGGCTGTGG + Intronic
989368156 5:40679427-40679449 GCGCTAGCGCGTGCGCCCCGGGG - Intergenic
989523284 5:42424909-42424931 GCGCGCGCGAGTGTGCGCCTGGG + Intronic
992487598 5:77210889-77210911 GGGCGCGGGCGGGCGCGCGGGGG + Exonic
993919148 5:93779127-93779149 GCGCGCGCGCGCACGTGCAGGGG + Intronic
996401473 5:123068115-123068137 GCACGCGCGCGTGTGTGGTGTGG + Intergenic
997237155 5:132279334-132279356 GCGCGCGCGCGTGGGTGTCGGGG - Intronic
997237158 5:132279342-132279364 GTGCGCGCGCGCGCGCGCGTGGG - Intronic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
998583234 5:143402761-143402783 GCTCGCGCTCGGGCGCGCCGGGG + Intronic
999330750 5:150672013-150672035 GCGCGTGCGCGTGTGTGTTGGGG - Intronic
1000071407 5:157743963-157743985 GCGCGGGCGCGGGCGGGCTCGGG + Exonic
1000463315 5:161547823-161547845 GTGCGCGCGGGTGCGCGCAGCGG - Intronic
1000907380 5:166978987-166979009 GCGCGCGCGCGTGTGTTGTGCGG + Intergenic
1001556813 5:172642155-172642177 GCGCCCGCGCGTGCCCGTGGAGG + Intronic
1001906576 5:175478515-175478537 GCGCGCGCGAGGACGCGCTCCGG + Exonic
1002515250 5:179753223-179753245 GCGCGCGCGCGCGCGCGTGCTGG + Intronic
1002515252 5:179753225-179753247 GCGCGCGCGCGCGCGTGCTGGGG + Intronic
1002648426 5:180673905-180673927 GAGCCCGCGTGTGCGCGATGTGG + Intergenic
1003086264 6:3063832-3063854 AGGCGCGCGCGTTCGCGCGGCGG - Intergenic
1004767717 6:18749550-18749572 GCGCGCGCGCACGCGCGCGCAGG - Intergenic
1004864121 6:19837247-19837269 GCGCGCGGGCGGGGGCGCGGAGG - Intergenic
1006125373 6:31834555-31834577 GCGCGCGCCCGCGCGCGCGCGGG + Intergenic
1006137242 6:31902397-31902419 ACGGGTGCGCGCGCGCGCTGCGG - Intronic
1006271987 6:32972082-32972104 GAGCGAGCGCGCGCGCGCGGAGG + Exonic
1006271989 6:32972084-32972106 GCGAGCGCGCGCGCGCGGAGGGG + Exonic
1006606250 6:35259735-35259757 GCGCGCGGGCGGGCGGGCTATGG + Exonic
1007161100 6:39792435-39792457 GCGGGAGCGCGGGCGCCCTGGGG + Intronic
1007392844 6:41560556-41560578 GCGCGCCCAGGAGCGCGCTGGGG + Intronic
1012872899 6:104693055-104693077 GTGCACGCGCGCGCGCGCTGGGG + Intergenic
1012912895 6:105137208-105137230 GCGCATGCGCGTGCGCGGTGCGG - Intergenic
1013507567 6:110815234-110815256 GCGCGCGCGCGCGCGAGAGGCGG - Exonic
1013575726 6:111482666-111482688 GCGTGTGCGCGTGTGCGCGGCGG + Intronic
1016340917 6:143060812-143060834 GCGCGGGCGCGGGCGCGGGGCGG - Intronic
1017662418 6:156687422-156687444 GCGGGCGCGCGTGCGCGGTGCGG + Intergenic
1018154441 6:160972777-160972799 GTGCGTGCGCGTGCGCGCAATGG - Intergenic
1018876528 6:167826872-167826894 GCGCGGGCGGGTGCGGGCGGCGG + Intergenic
1019474537 7:1237578-1237600 GTGCGCGCGGGGGCGCGCGGCGG - Intergenic
1019711353 7:2519574-2519596 GGGCGTGCACGTGCGCGCCGGGG + Intronic
1021107625 7:16656540-16656562 GTGTGTGCGCGCGCGCGCTGGGG - Intronic
1021827897 7:24573207-24573229 GCGCGCGCTCGGGCGCGAGGAGG - Intergenic
1023945122 7:44796898-44796920 GGGCGAGCGCGGGCGGGCTGCGG + Intronic
1023972157 7:44999803-44999825 GCGCGCGCGGGAGCGCGCGCGGG - Intronic
1026000348 7:66556270-66556292 GCGCGGGCGCGGGCGCGAGGGGG - Intergenic
1029496324 7:100896987-100897009 GCGTGCGTGCGCGCGCGCGGCGG + Intergenic
1029536992 7:101162942-101162964 GCGCCGGCGCGCGCGCGCGGCGG + Exonic
1031213281 7:118858667-118858689 GAGCGCGCGCGCGCGCGCGTGGG - Intergenic
1033300017 7:140177050-140177072 GCGCGCGCGCGAGGCCGCGGCGG + Intergenic
1034147328 7:148884468-148884490 GCGCGTGCGCGCGCGGGCGGCGG + Intergenic
1034349160 7:150405322-150405344 GTGCGCGCGGGGCCGCGCTGGGG + Intronic
1035023510 7:155812167-155812189 CCGTGCGCGAGTGCGCGCGGCGG + Exonic
1036664516 8:10730165-10730187 GCGCGCGGCCGAGCGGGCTGGGG - Intronic
1037878411 8:22560871-22560893 GTGCGCGCGCGCACGCGCCGTGG + Intronic
1037878413 8:22560873-22560895 GCGCGCGCGCACGCGCCGTGGGG + Intronic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1037900478 8:22685429-22685451 GCGCGCGCGCGCGCGCGGGGAGG + Intergenic
1037900480 8:22685431-22685453 GCGCGCGCGCGCGCGGGGAGGGG + Intergenic
1037901039 8:22689991-22690013 GCAGGCGCGCGTGCGTGCGGCGG + Exonic
1038727663 8:30095610-30095632 GCGCGCGCGCGAGCCCGGAGGGG - Intronic
1038767909 8:30446841-30446863 GTGCGCGCGCGCGCGCGCGGTGG + Intronic
1039595454 8:38787133-38787155 GCGCGCGCGCGCGGGGGCGGCGG - Intronic
1041689885 8:60678650-60678672 GCGCGGGCGCGGGCGCGGCGCGG + Intergenic
1043464708 8:80493186-80493208 GCGCGCGCGCGCGCGTTTTGAGG - Intronic
1044115311 8:88327743-88327765 GCGCGCGCGCGCGCGCGCCAAGG - Intronic
1044719692 8:95133760-95133782 GGGCGCGCCCGTGCGCGCGCAGG + Intergenic
1044719694 8:95133762-95133784 GCGCGCCCGTGCGCGCGCAGGGG + Intergenic
1046680189 8:117160435-117160457 GCGCGCACATGTGCGCGCGGTGG + Intronic
1050343832 9:4666529-4666551 GAGGGCGCGCGTCTGCGCTGGGG - Exonic
1050445787 9:5721433-5721455 GTGCACGCGCGTGTGTGCTGGGG - Intronic
1053137122 9:35658294-35658316 TCGCGTGCGCGTGCGCGTTGGGG + Exonic
1053555528 9:39133052-39133074 CCGAGCGCGGGTGCCCGCTGGGG + Exonic
1054842662 9:69760012-69760034 GAGCGCGCGCGCGCGCGCGCGGG + Intergenic
1054842663 9:69760020-69760042 GCGCGCGCGCGCGGGTGCTTCGG + Intergenic
1055030368 9:71767873-71767895 GCGCGCGCGCTTGTGCGTTTGGG - Intronic
1055158921 9:73100353-73100375 GCGCGCGCGCGCGCGTGCATAGG + Intergenic
1057245603 9:93451878-93451900 GCGGGCGCGGGTGCGGGCGGGGG - Exonic
1057489405 9:95509588-95509610 GCGCGCGTGTGTGCGCGCAAAGG - Intronic
1057619106 9:96619421-96619443 GCGCGCCCGCGCGCCCGCCGAGG + Exonic
1058058551 9:100473242-100473264 GCGGGCGGGCGCGCGCGCGGCGG - Exonic
1058602538 9:106685482-106685504 ACGCGCGCGCGCGCGCGCACAGG - Intergenic
1059270466 9:113067532-113067554 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059271603 9:113072982-113073004 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059272734 9:113078426-113078448 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059273868 9:113083868-113083890 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059275001 9:113089312-113089334 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1060283373 9:122228490-122228512 GCGCGCGCGCGAGCGGGGGGGGG - Intronic
1061453492 9:130681582-130681604 GCGCGGGCGCGTGCGCGTGCGGG - Exonic
1062004208 9:134231168-134231190 GCGCACGTGTGTGCACGCTGTGG - Intergenic
1203471789 Un_GL000220v1:118423-118445 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1203471791 Un_GL000220v1:118425-118447 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1185778802 X:2828819-2828841 GCGCGCGGGCTTGCGGGCAGGGG + Exonic
1186768145 X:12791758-12791780 GCGCGGGCGCGGGGGCGCGGAGG - Intronic
1187067551 X:15855069-15855091 GCGCGGGCGCGCGGGCGCTCGGG - Intergenic
1187265002 X:17723769-17723791 GTGCGCGCGCGTGCGCGCATGGG + Intronic
1187648353 X:21374270-21374292 GCGCGTGCGCGTGCGCGTGCCGG - Intergenic
1188597814 X:31922524-31922546 GTGCGCGCGCGTGCGCTAGGGGG + Intronic
1189322889 X:40097150-40097172 GTGGGCGGGCGGGCGCGCTGAGG - Intronic
1190246986 X:48697070-48697092 GCCCCCGCGCGTGCGCGCGCCGG - Intronic
1190862635 X:54358648-54358670 GCCCCCGCGCGCGCGCACTGCGG - Intergenic
1195316844 X:103687494-103687516 GCACGCGCGCGCGCCCGCCGTGG - Intronic
1198441506 X:136667841-136667863 GTGCGTGCACGTGCGCGCTTGGG - Exonic
1199086454 X:143634724-143634746 GCGCGCGCGCACGCGAGCCGAGG - Intronic
1199760116 X:150898700-150898722 CCGCGCGCGCGCGCGGGCTTTGG - Exonic
1199760118 X:150898705-150898727 GCCCGCGCGCGCGCGCGGCGCGG + Exonic
1200240545 X:154490794-154490816 GCGCCGGCGCGGGCGCGGTGCGG + Intergenic
1201291217 Y:12421686-12421708 GCGCGCGGGCTTGCGGGCAGGGG - Intergenic
1201575343 Y:15456282-15456304 GCGCGTGCGCGTGCGCGAAGCGG - Intergenic