ID: 1119325727

View in Genome Browser
Species Human (GRCh38)
Location 14:73758867-73758889
Sequence AGGCCTCTGGGTAAAGGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 172}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119325727_1119325739 20 Left 1119325727 14:73758867-73758889 CCTAGACCTTTACCCAGAGGCCT 0: 1
1: 0
2: 0
3: 19
4: 172
Right 1119325739 14:73758910-73758932 TGGTCCTGCATGTGCGACTTGGG 0: 1
1: 0
2: 0
3: 2
4: 59
1119325727_1119325736 0 Left 1119325727 14:73758867-73758889 CCTAGACCTTTACCCAGAGGCCT 0: 1
1: 0
2: 0
3: 19
4: 172
Right 1119325736 14:73758890-73758912 TGGGGGCAACCTGACACACATGG 0: 1
1: 0
2: 1
3: 10
4: 220
1119325727_1119325738 19 Left 1119325727 14:73758867-73758889 CCTAGACCTTTACCCAGAGGCCT 0: 1
1: 0
2: 0
3: 19
4: 172
Right 1119325738 14:73758909-73758931 ATGGTCCTGCATGTGCGACTTGG 0: 1
1: 0
2: 1
3: 11
4: 54
1119325727_1119325740 23 Left 1119325727 14:73758867-73758889 CCTAGACCTTTACCCAGAGGCCT 0: 1
1: 0
2: 0
3: 19
4: 172
Right 1119325740 14:73758913-73758935 TCCTGCATGTGCGACTTGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119325727 Original CRISPR AGGCCTCTGGGTAAAGGTCT AGG (reversed) Intronic
900398962 1:2465133-2465155 AGGGCTGTGGGCCAAGGTCTAGG + Intronic
901225605 1:7611400-7611422 AGGCCTCTGGCCAAAGGGCTTGG + Intronic
904908721 1:33917992-33918014 AGGCCTCTGGCTGCAGGTCCAGG + Intronic
904935882 1:34129164-34129186 AAGAATCTGTGTAAAGGTCTGGG + Intronic
906178331 1:43795966-43795988 AGACCTCTAGTTAAAGCTCTGGG + Intronic
906224224 1:44107657-44107679 TGGTCGCTTGGTAAAGGTCTCGG + Intergenic
907073749 1:51560583-51560605 AGGCCCCAGAGTAAAGGCCTTGG - Intergenic
908413288 1:63887570-63887592 TTGCCTCTGGGTAGAGGTGTGGG - Intronic
908940785 1:69431117-69431139 AGGGCTCAGGCCAAAGGTCTAGG + Intergenic
909666545 1:78140579-78140601 AGACCTCAAAGTAAAGGTCTAGG - Intergenic
910241425 1:85090764-85090786 AGGACCCTGGGTAGAGTTCTGGG + Intronic
911012456 1:93295832-93295854 AGGCGTCTAGATAAAGGTATCGG + Intergenic
911295414 1:96108613-96108635 AGGCCTCTAGTTCTAGGTCTGGG - Intergenic
915568744 1:156732334-156732356 AGGCATCCGGGTAAAGGCCAGGG - Exonic
916938316 1:169654426-169654448 AGGACTGGGGGTACAGGTCTTGG - Intergenic
917087245 1:171316214-171316236 AGGCCACTAGGTAGAGGCCTGGG - Exonic
918538114 1:185596986-185597008 AGGTCTCTGGGTAGAGCTCTGGG - Intergenic
924068735 1:240254415-240254437 AAGCCTCTGGGTGGTGGTCTTGG + Intronic
924253575 1:242159595-242159617 AGACCTATGGGTGGAGGTCTGGG - Intronic
924645740 1:245875943-245875965 AGTCCTCTGAATGAAGGTCTGGG - Intronic
1063657057 10:8001133-8001155 AGACAGCTGTGTAAAGGTCTGGG - Intronic
1064148893 10:12846981-12847003 AGGCATCTTGGTTATGGTCTAGG - Intergenic
1064261832 10:13792337-13792359 AGACCTCTGGCCACAGGTCTTGG + Intronic
1067461061 10:46459072-46459094 AGGCCTCTGGGGAAAGTGTTTGG - Intergenic
1067626133 10:47925529-47925551 AGGCCTCTGGGGAAAGTGTTTGG + Intergenic
1069902326 10:71713337-71713359 AGGCCTCTGGGCAGAGGTGTGGG - Exonic
1069923390 10:71831366-71831388 AGCCCTCAGGGAAAAGGACTTGG + Intronic
1070137589 10:73708217-73708239 AGGCTACTGGGAAAAGTTCTTGG + Intergenic
1071076458 10:81759384-81759406 ATGCCTCTGGGTATAGATCCTGG - Intergenic
1073642370 10:105265822-105265844 GGACCTCTGAGCAAAGGTCTTGG + Intergenic
1074854342 10:117462313-117462335 AGGGCTTTGGGTCAAGGTTTGGG - Intergenic
1075712085 10:124536215-124536237 AGGCCTCTGGGCAAAATACTCGG - Intronic
1079104276 11:17560495-17560517 AGTTCTCTGAGCAAAGGTCTAGG + Intronic
1081802937 11:45872094-45872116 GGGCCACTGGGTAGTGGTCTTGG - Exonic
1083720224 11:64600253-64600275 AGGCCTCTTTGTAAATGTTTGGG - Intronic
1083724548 11:64621408-64621430 AGCCCTTGGGGAAAAGGTCTGGG - Intronic
1084279724 11:68080122-68080144 AGGCCTCTGCACAAAGGGCTTGG + Intronic
1088828443 11:113515376-113515398 AGGCACCTGTGTAAAGGCCTGGG + Intergenic
1090267790 11:125364455-125364477 AGGACTTTGGGGAAAGGTGTGGG - Intronic
1094249350 12:28341315-28341337 AGGCCCATGGGCACAGGTCTGGG + Intronic
1095906564 12:47384175-47384197 AGGCCTTTGGGAAAATGTCCAGG + Intergenic
1096812849 12:54182735-54182757 AGGCCTTTGGGTGAAGGTAGGGG - Intronic
1097056433 12:56252724-56252746 AGGGAGCTGGGCAAAGGTCTGGG - Intronic
1097687023 12:62700648-62700670 AGGCCTCTGTGCAATGATCTAGG + Intronic
1099599930 12:84722055-84722077 TGGCCTCTGGGTATAGGGCCAGG - Intergenic
1102471969 12:113164300-113164322 AGGCCAGTGGGCAAAGGACTGGG - Intronic
1102512145 12:113422809-113422831 TGGCCTCTGGGGAAAGGCTTTGG + Intronic
1102612936 12:114128528-114128550 AGGCATCTGGATAAAGGCTTTGG + Intergenic
1103257743 12:119556822-119556844 GGGCCTCTGGTTACAGGTTTTGG + Intergenic
1105021385 12:132818847-132818869 AGCCTGCTGGGTAAAGGCCTGGG + Intronic
1105640181 13:22253802-22253824 AGGCCTCTGGTTACATTTCTTGG - Intergenic
1105830313 13:24158355-24158377 TGGCCTCTGTGTAAAAGCCTAGG - Intronic
1105837040 13:24221299-24221321 AGGCCTCTGCCCTAAGGTCTTGG - Intronic
1106412766 13:29522594-29522616 AGGCCTGTGGCTAAAAGACTTGG + Intronic
1113785184 13:112998745-112998767 CTGTCTCTGGCTAAAGGTCTAGG + Intronic
1115743124 14:36409200-36409222 AGGCCTTAGGGTAACAGTCTTGG + Intergenic
1117583639 14:57178046-57178068 AGGCCTCAGGGAAAAACTCTGGG + Intergenic
1118667516 14:68086478-68086500 AGGCCTGTGGGCCCAGGTCTGGG + Intronic
1119325727 14:73758867-73758889 AGGCCTCTGGGTAAAGGTCTAGG - Intronic
1121835406 14:97087900-97087922 AGGTCCCTGGGTGAGGGTCTGGG + Intergenic
1124708162 15:31982752-31982774 AGGTCTCTGGGAACAGGTCTTGG - Intergenic
1125685561 15:41561315-41561337 AGGCCTGTGGGGGAAGGTGTGGG + Intronic
1128730067 15:70014976-70014998 AGGCCTCTGGGGAAAGGAAGAGG + Intergenic
1130691859 15:86088367-86088389 ATGCCTCTGGGTGCAAGTCTTGG + Intergenic
1135707344 16:24686214-24686236 AGGCGTCTGGGCAAAAGCCTGGG + Intergenic
1139653654 16:68374955-68374977 AGGCCTCAGGTTAAAGGTCCAGG + Intronic
1140129800 16:72150496-72150518 TGACATCTGGGTAAAGGTTTGGG + Intronic
1141684453 16:85562323-85562345 AGGCCCCTCGGAAAAGGGCTGGG - Intergenic
1143165821 17:4896866-4896888 AGGCCCCTGGGCAGAGTTCTGGG + Intronic
1143327636 17:6109876-6109898 ATGTGTCTGTGTAAAGGTCTTGG + Intronic
1143401851 17:6651429-6651451 AGGCCACGGGGAAGAGGTCTGGG + Intronic
1143687997 17:8534654-8534676 TGGCCTCAGGGTCAAGGTCTAGG + Intronic
1145262598 17:21363832-21363854 AGGCCTCTGGGAAGATCTCTGGG + Intergenic
1146312575 17:31780464-31780486 GGGCCCCTGGGTTAAGGTCATGG + Intergenic
1146546333 17:33741978-33742000 AGGCCAGTGGTCAAAGGTCTAGG + Intronic
1150662861 17:67100481-67100503 AGGCATCTTTGTAAAAGTCTCGG - Intronic
1153842861 18:9022640-9022662 AGGCCTCTGGGTTGATGACTGGG - Intergenic
1158634562 18:59145472-59145494 AGCCTTCTGGGTAAAGGCCCTGG + Intronic
1161216474 19:3097248-3097270 AGACCTCTGGGTGGAGGTCCTGG + Intronic
1161851207 19:6739052-6739074 AGGCAGCTGGGGAAAGGCCTGGG + Intronic
1164665934 19:30036803-30036825 AGGCCTCTGTCTGAGGGTCTCGG + Intergenic
1164794058 19:31012152-31012174 AGGGCCCTGGGAAATGGTCTAGG - Intergenic
1165308940 19:35019133-35019155 TGGCCTGTGGGCAAAGGACTGGG + Intronic
1166043142 19:40215066-40215088 AGGTCTCGGGGCAAAGGTCAGGG - Exonic
1167431801 19:49459468-49459490 AGGATGCTGTGTAAAGGTCTTGG - Intronic
925048930 2:796233-796255 AGGCCCCTGGGAACAGGCCTTGG + Intergenic
925286396 2:2718443-2718465 GGGCCTCTGGGGAAAGGCATGGG - Intergenic
927694441 2:25230622-25230644 GGGCCTCTGGGGACAGGTATTGG - Exonic
927712570 2:25334719-25334741 AGGCCTCTGAGCAAAGGCCTAGG - Intronic
928177376 2:29044099-29044121 ATGCCCATGGGTAAAGTTCTGGG - Intronic
931665534 2:64607661-64607683 AGGCCTTTGGGTTAATGTGTTGG + Intergenic
931673025 2:64665878-64665900 AGGCCTCGGCCTAAAGGTCTAGG + Intronic
932460839 2:71880918-71880940 TGGCAGCTGGGGAAAGGTCTTGG + Intergenic
932499859 2:72173943-72173965 AGGCCTCTGGGGAAAGGGTTTGG + Intergenic
934880289 2:97971192-97971214 AGGGCACTGGGTAAAGGTCAGGG + Intronic
935062916 2:99623639-99623661 AGGCCTCTGGGTTAGGGTCGGGG + Intronic
936010396 2:108921743-108921765 AGCCCTCTGGGTTAGGGCCTCGG - Intronic
940013366 2:149078237-149078259 AGGCCTCTGTGCAGAGGTCATGG - Intronic
942061218 2:172230342-172230364 AGGTCCCTGAGTAAAGATCTTGG + Intergenic
947178211 2:227388594-227388616 AGGCTTCTGGGCTAAGCTCTGGG - Intergenic
947660235 2:231861075-231861097 GGGCCTCATGGAAAAGGTCTTGG + Intergenic
948186353 2:236024431-236024453 AGGTCTCAGGGAAAGGGTCTGGG - Intronic
1170561555 20:17563017-17563039 CGGCCTGTTGGTAAAGGGCTTGG + Intronic
1170830789 20:19838902-19838924 AGGCCACTGGGTGGAGGTTTGGG - Intergenic
1174485203 20:50856617-50856639 AGGCCTCTGGAGCCAGGTCTAGG - Intronic
1175254428 20:57630773-57630795 AGATCACTGGGTGAAGGTCTAGG + Intergenic
1175791539 20:61743373-61743395 AGGCCTCTGGCTAATTCTCTAGG + Intronic
1175853476 20:62106129-62106151 AGGCCTTTGGATAAAGGTTTTGG - Intergenic
1175910490 20:62403025-62403047 ATGCTTCTGGGGAAAGGCCTGGG - Intronic
1175958182 20:62622010-62622032 TGGCCTCTGGGGAAAGGACCTGG + Intergenic
1176029124 20:63002581-63002603 AGGCCACAGAGTAAAGGTGTGGG - Intergenic
1177126303 21:17197482-17197504 AGGCCTTTGGGTCAAGATGTTGG - Intergenic
1179874482 21:44261226-44261248 CGGCCTCTGGGTCCAGGGCTGGG + Exonic
1181097597 22:20516492-20516514 AGGGCTGGGGGTTAAGGTCTGGG - Intronic
1181586773 22:23857025-23857047 CGTCCTCTGGGGAAAGGTCGGGG + Intronic
1182711812 22:32327924-32327946 AGGACTCTGGTTAAACATCTTGG - Intergenic
1183421522 22:37714240-37714262 GGGACTCTGGGCAAAGCTCTTGG + Intronic
1183490902 22:38115120-38115142 AGGCCTCTGCTAAAAGGCCTGGG - Intronic
1184399324 22:44264629-44264651 AGGACTCTGGTTAAACATCTTGG - Intronic
1185395856 22:50587604-50587626 ATGCCTCAGGGTGAAGGTCTGGG + Intronic
949533869 3:4980436-4980458 CGCCCTCTGGGCAAAGGACTGGG - Intronic
953666239 3:44928420-44928442 AGGGCTCTGGGTGAAGGTTTGGG - Intronic
954117087 3:48473020-48473042 AGGCCTCTGGGTGAAGGCAGAGG - Intronic
955772665 3:62401578-62401600 AGGCCTCTGGGTGATGTTCTTGG + Intronic
957360962 3:79157172-79157194 AGTCCTCTGGGGAAATGTTTGGG + Intronic
960877870 3:122315120-122315142 AGGTCTGTGGGCACAGGTCTGGG - Intergenic
962100155 3:132333466-132333488 AGGTCACTGGGCAAAAGTCTGGG - Intronic
962212552 3:133491297-133491319 AGGCATCTGGGTCCATGTCTGGG - Intergenic
962241249 3:133753118-133753140 AGGGCTCTGAGCAAAGGTCATGG + Intronic
963325782 3:143861431-143861453 AGGACTCTGTGCAAAGGTTTAGG - Intergenic
963328958 3:143892896-143892918 AAGTATCTGGGGAAAGGTCTTGG + Intergenic
966304345 3:178513825-178513847 AAGCCTCTGGGAAAAGCACTGGG - Intronic
971847586 4:31940402-31940424 AGGCCTCTGGATGACTGTCTAGG - Intergenic
978299561 4:107251379-107251401 AGAGCTCTGGGTAGAGCTCTTGG + Intronic
980457890 4:133069232-133069254 AGGCCTCTGGGCAGAGGGCTCGG + Intergenic
981997595 4:150991382-150991404 AGGCCTATAGGCAAAGGTTTGGG + Intronic
982291252 4:153784884-153784906 ATGCCTCTGGGTGAAGTTCCTGG + Intronic
984870090 4:184317745-184317767 AGGCCTCTGGGTAAGGGATGGGG - Intergenic
985017375 4:185650838-185650860 AGCCCTCTGGGTTTAAGTCTTGG - Intronic
987901094 5:24013102-24013124 AGGCACCTGGGGAAAGTTCTCGG + Intronic
992693465 5:79261209-79261231 AAACCTCAGGGTAAAGATCTTGG - Intronic
995356222 5:111240709-111240731 AGGCCTCTCGGTAAAGGAGGAGG + Intronic
995893985 5:116990010-116990032 AGGCCACTGGGGAAAATTCTGGG - Intergenic
998176665 5:139905511-139905533 AGGACTCTGGGTCAAGGCCAGGG + Intronic
998426486 5:142033269-142033291 AGGCATCTGGGTAAAGATGCGGG + Intergenic
999108426 5:149093976-149093998 AGGCCCCTGGGCAATGGTCATGG - Intergenic
1000007740 5:157203041-157203063 AGCCATCTGGGAGAAGGTCTAGG - Intronic
1000202213 5:159022400-159022422 AGGCCTCGGGGTAAAGTGCGCGG + Intronic
1001483633 5:172104971-172104993 AGGTGTGTGGGAAAAGGTCTTGG - Intronic
1001635426 5:173206673-173206695 AGTCCTCTGGATAAAAGTCTCGG + Intergenic
1002163528 5:177331301-177331323 GGGCCTCTGGGTAAAAGGATGGG - Intergenic
1004169326 6:13283697-13283719 TGGCCCCTGGGGAAAGGTGTTGG - Intronic
1004653669 6:17636416-17636438 AGGGCTCAGGCAAAAGGTCTAGG + Intronic
1006635002 6:35455870-35455892 AGGCATCTGGGTCAGGGGCTAGG - Exonic
1006887651 6:37395893-37395915 TGGCCTCTGGGATAAGTTCTGGG - Intergenic
1006927312 6:37664212-37664234 AGGCCTCTGAGGAATGGCCTGGG - Intronic
1007163969 6:39815107-39815129 AGGCTTCTGGATCAAGCTCTAGG + Intronic
1015871252 6:137778686-137778708 AGGCCTGTTGGTAAAGGGGTGGG - Intergenic
1017530312 6:155283731-155283753 AGGCCTATGAGTAAGGATCTTGG + Intronic
1018927893 6:168219508-168219530 AGGCCTCTGGGAAAGGGCGTGGG - Intergenic
1020735789 7:11947935-11947957 AGGCCACTGCGTAAAGGTAAAGG - Intergenic
1021584822 7:22196844-22196866 AGGCCTCTGGACAAAGGTCAAGG + Intronic
1021788116 7:24172830-24172852 AGGACTCTGGGTTAAAGTATAGG - Intergenic
1025725987 7:64060595-64060617 AGCCCACTGGCTAAAGATCTGGG - Intronic
1025929531 7:65982666-65982688 TGGCCCCTGGGTTAAGGTCAGGG - Intergenic
1029595402 7:101535122-101535144 AGGCCCCTGGGCACAGGCCTGGG + Intronic
1030200248 7:106895621-106895643 AGGTCTCTTAGTAAAGGCCTAGG - Intronic
1032550170 7:132777479-132777501 AGGCCTTTGGATATATGTCTGGG - Intergenic
1034640021 7:152595088-152595110 ACGCCCCTGGGTTCAGGTCTCGG + Intergenic
1040073135 8:43204559-43204581 AGCCCTGTGGGTCAAGGTCGAGG - Intergenic
1044368468 8:91378538-91378560 AAGCATCTTGCTAAAGGTCTGGG + Intronic
1046350253 8:113000061-113000083 AGGCTTCTGCCTAAAGTTCTGGG - Intronic
1048083037 8:131149201-131149223 AGGTCTGTGGGCACAGGTCTGGG + Intergenic
1048153949 8:131923478-131923500 AGGCATCTGGGAAAATGTCAGGG + Intronic
1048424033 8:134306130-134306152 AGCCCTCTGGGCCAAGGCCTGGG - Intergenic
1048850498 8:138640933-138640955 AGGCCTGTGGGCACAGGCCTGGG - Intronic
1049778880 8:144418442-144418464 TAGCTTCTGGGCAAAGGTCTTGG + Intergenic
1049991799 9:998395-998417 AGGCGGCTGGGCAAAGGTCCAGG - Intergenic
1053023993 9:34715562-34715584 AGTCCTCTGGGTGAAGATGTTGG + Intergenic
1058651803 9:107181890-107181912 AGCCCTCTGGGTAAATGTGGTGG - Intergenic
1059257650 9:112945686-112945708 AGGCCTCTTCCAAAAGGTCTGGG - Intergenic
1060547169 9:124468384-124468406 AGGCCTCTGGGTAGCAGCCTGGG - Intronic
1061497068 9:130981246-130981268 AGTTCTTTGGGTGAAGGTCTTGG + Intergenic
1186478810 X:9880113-9880135 AGGGATCTGGGGACAGGTCTTGG + Intronic
1188263132 X:28040766-28040788 AGGCCTTTGGGGAGAGGTTTGGG - Intergenic
1189623365 X:42868337-42868359 AAGGCTCTGGGTAAAGTTCAGGG + Intergenic
1191911932 X:66160696-66160718 AGACCTCTGGGGAAAGGTGGAGG - Intergenic
1192330643 X:70172837-70172859 AGGGCTCTGGGTCCAGGTCCTGG + Intergenic
1194764676 X:97836145-97836167 AGGGCTCAGGGTGGAGGTCTAGG - Intergenic
1198527302 X:137514380-137514402 AGACCTCAGGAGAAAGGTCTGGG + Intergenic
1200059010 X:153475854-153475876 GGGCCTCAGGGTCAAGGTCTGGG - Intronic
1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG + Intronic