ID: 1119325735

View in Genome Browser
Species Human (GRCh38)
Location 14:73758887-73758909
Sequence TGTGTGTCAGGTTGCCCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119325735_1119325739 0 Left 1119325735 14:73758887-73758909 CCTTGGGGGCAACCTGACACACA 0: 1
1: 0
2: 1
3: 9
4: 112
Right 1119325739 14:73758910-73758932 TGGTCCTGCATGTGCGACTTGGG 0: 1
1: 0
2: 0
3: 2
4: 59
1119325735_1119325742 29 Left 1119325735 14:73758887-73758909 CCTTGGGGGCAACCTGACACACA 0: 1
1: 0
2: 1
3: 9
4: 112
Right 1119325742 14:73758939-73758961 CGTGACCAGCTCCACCAAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 158
1119325735_1119325740 3 Left 1119325735 14:73758887-73758909 CCTTGGGGGCAACCTGACACACA 0: 1
1: 0
2: 1
3: 9
4: 112
Right 1119325740 14:73758913-73758935 TCCTGCATGTGCGACTTGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 92
1119325735_1119325738 -1 Left 1119325735 14:73758887-73758909 CCTTGGGGGCAACCTGACACACA 0: 1
1: 0
2: 1
3: 9
4: 112
Right 1119325738 14:73758909-73758931 ATGGTCCTGCATGTGCGACTTGG 0: 1
1: 0
2: 1
3: 11
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119325735 Original CRISPR TGTGTGTCAGGTTGCCCCCA AGG (reversed) Intronic