ID: 1119325974

View in Genome Browser
Species Human (GRCh38)
Location 14:73759755-73759777
Sequence CCACTTACCCAGCTCTTGCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 1, 2: 2, 3: 13, 4: 215}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119325955_1119325974 27 Left 1119325955 14:73759705-73759727 CCCCTCGCCGGCCCCGCCGCGTG 0: 1
1: 0
2: 0
3: 21
4: 276
Right 1119325974 14:73759755-73759777 CCACTTACCCAGCTCTTGCCCGG 0: 1
1: 1
2: 2
3: 13
4: 215
1119325956_1119325974 26 Left 1119325956 14:73759706-73759728 CCCTCGCCGGCCCCGCCGCGTGC 0: 1
1: 0
2: 1
3: 31
4: 375
Right 1119325974 14:73759755-73759777 CCACTTACCCAGCTCTTGCCCGG 0: 1
1: 1
2: 2
3: 13
4: 215
1119325961_1119325974 16 Left 1119325961 14:73759716-73759738 CCCCGCCGCGTGCAGGCCTCGGC 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1119325974 14:73759755-73759777 CCACTTACCCAGCTCTTGCCCGG 0: 1
1: 1
2: 2
3: 13
4: 215
1119325969_1119325974 -9 Left 1119325969 14:73759741-73759763 CCGGCCAGGCAGCCCCACTTACC 0: 1
1: 0
2: 3
3: 35
4: 271
Right 1119325974 14:73759755-73759777 CCACTTACCCAGCTCTTGCCCGG 0: 1
1: 1
2: 2
3: 13
4: 215
1119325964_1119325974 11 Left 1119325964 14:73759721-73759743 CCGCGTGCAGGCCTCGGCCGCCG 0: 1
1: 0
2: 0
3: 8
4: 144
Right 1119325974 14:73759755-73759777 CCACTTACCCAGCTCTTGCCCGG 0: 1
1: 1
2: 2
3: 13
4: 215
1119325957_1119325974 25 Left 1119325957 14:73759707-73759729 CCTCGCCGGCCCCGCCGCGTGCA 0: 1
1: 0
2: 2
3: 26
4: 280
Right 1119325974 14:73759755-73759777 CCACTTACCCAGCTCTTGCCCGG 0: 1
1: 1
2: 2
3: 13
4: 215
1119325959_1119325974 20 Left 1119325959 14:73759712-73759734 CCGGCCCCGCCGCGTGCAGGCCT 0: 1
1: 0
2: 2
3: 31
4: 275
Right 1119325974 14:73759755-73759777 CCACTTACCCAGCTCTTGCCCGG 0: 1
1: 1
2: 2
3: 13
4: 215
1119325967_1119325974 0 Left 1119325967 14:73759732-73759754 CCTCGGCCGCCGGCCAGGCAGCC 0: 1
1: 0
2: 4
3: 33
4: 461
Right 1119325974 14:73759755-73759777 CCACTTACCCAGCTCTTGCCCGG 0: 1
1: 1
2: 2
3: 13
4: 215
1119325968_1119325974 -6 Left 1119325968 14:73759738-73759760 CCGCCGGCCAGGCAGCCCCACTT 0: 1
1: 0
2: 1
3: 16
4: 257
Right 1119325974 14:73759755-73759777 CCACTTACCCAGCTCTTGCCCGG 0: 1
1: 1
2: 2
3: 13
4: 215
1119325962_1119325974 15 Left 1119325962 14:73759717-73759739 CCCGCCGCGTGCAGGCCTCGGCC 0: 1
1: 0
2: 1
3: 14
4: 197
Right 1119325974 14:73759755-73759777 CCACTTACCCAGCTCTTGCCCGG 0: 1
1: 1
2: 2
3: 13
4: 215
1119325963_1119325974 14 Left 1119325963 14:73759718-73759740 CCGCCGCGTGCAGGCCTCGGCCG 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1119325974 14:73759755-73759777 CCACTTACCCAGCTCTTGCCCGG 0: 1
1: 1
2: 2
3: 13
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119325974 Original CRISPR CCACTTACCCAGCTCTTGCC CGG Exonic
900242723 1:1624654-1624676 CCGCAGCCCCAGCTCTTGCCCGG - Intronic
901672641 1:10865215-10865237 CCATTTTCCCAGCACTTTCCAGG - Intergenic
902459960 1:16566995-16567017 TCACTGACCCATCCCTTGCCTGG + Intronic
902604940 1:17563921-17563943 GCACTGACCCAGCTGTTGTCTGG - Intronic
902676649 1:18013389-18013411 CAGCTTCCCCAGCCCTTGCCTGG + Intergenic
903667556 1:25017223-25017245 CCCCGTGCCCAGCTCTTCCCTGG + Intergenic
904756372 1:32770839-32770861 CCAGGTACCCAGCTGTTGGCTGG - Exonic
904851991 1:33466555-33466577 CATCTCACCCAGCTCCTGCCAGG + Intergenic
906178289 1:43795521-43795543 ACCTCTACCCAGCTCTTGCCTGG - Intronic
906179391 1:43805299-43805321 CCACTAACCTAGCTTTTGTCAGG + Intronic
906208848 1:44001145-44001167 TCCCTTACGCAGCTCTTACCTGG + Exonic
908239335 1:62175778-62175800 CCATTTACCTGGCTCCTGCCTGG + Intergenic
912431238 1:109629577-109629599 CCTCTGACCCACCTGTTGCCTGG + Intronic
912711998 1:111956666-111956688 CCACTTCCACAGCTCCTTCCAGG + Intronic
913610152 1:120503039-120503061 GCACTTTCCCAGCCCTAGCCAGG - Intergenic
913984650 1:143553799-143553821 GCACTTTCCCAGCCCTAGCCAGG + Intergenic
914177651 1:145293019-145293041 TCACTGACCCATCCCTTGCCTGG + Intronic
914178196 1:145297777-145297799 TCACTGACCCATCCCTTGCCTGG + Intronic
914178741 1:145302539-145302561 TCACTGACCCATCCCTTGCCTGG + Intronic
914179119 1:145305708-145305730 TCACTGACCCATCCCTTGCCTGG + Intronic
914179495 1:145308891-145308913 TCACTGACCCATCCCTTGCCTGG + Intronic
914180039 1:145313647-145313669 TCACTGACCCATCCCTTGCCTGG + Intronic
914180584 1:145318419-145318441 TCACTGACCCATCCCTTGCCTGG + Intronic
914181127 1:145323181-145323203 TCACTGACCCATCCCTTGCCTGG + Intronic
914181670 1:145327929-145327951 TCACTGACCCATCCCTTGCCTGG + Intronic
914182215 1:145332696-145332718 TCACTGACCCATCCCTTGCCTGG + Intronic
914182760 1:145337452-145337474 TCACTGACCCATCCCTTGCCTGG + Intronic
914183305 1:145342202-145342224 TCACTGACCCATCCCTTGCCTGG + Intronic
914183849 1:145346960-145346982 TCACTGACCCATCCCTTGCCTGG + Intronic
914184393 1:145351732-145351754 TCACTGACCCATCCCTTGCCTGG + Intronic
914184937 1:145356494-145356516 TCACTGACCCATCCCTTGCCTGG + Intronic
914185482 1:145361241-145361263 TCACTGACCCATCCCTTGCCTGG + Intronic
914186028 1:145365995-145366017 TCACTGACCCATCCCTTGCCTGG + Intronic
914186574 1:145370755-145370777 TCACTGACCCATCCCTTGCCTGG + Intronic
914187118 1:145375503-145375525 TCACTGACCCATCCCTTGCCTGG + Intronic
914187661 1:145380255-145380277 TCACTGACCCATCCCTTGCCTGG + Intronic
914188206 1:145385009-145385031 TCACTGACCCATCCCTTGCCTGG + Intronic
914188749 1:145389759-145389781 TCACTGACCCATCCCTTGCCTGG + Intronic
914581038 1:149019200-149019222 GCACTTTCCCAGCCCTAGCCAGG + Intronic
915081403 1:153355115-153355137 CCTCTGAGCCAGCCCTTGCCTGG + Intergenic
915475446 1:156150249-156150271 CCCCTTACCCAGAGCTTCCCAGG - Intronic
915930431 1:160057502-160057524 ACACTTGCCCACCTCTTGGCAGG - Intronic
923096268 1:230777683-230777705 CCACTAACCCTGATCTTGCCAGG + Intronic
923667001 1:236007372-236007394 CCACTGACCCTGACCTTGCCTGG - Intronic
1069799125 10:71071381-71071403 CCTCTTTCCCAGCTCATGCACGG - Intergenic
1070016738 10:72541150-72541172 CCAATTCCCGGGCTCTTGCCCGG - Intronic
1070417813 10:76206748-76206770 CCACTTTCCCCTCTCATGCCTGG + Intronic
1070724811 10:78780642-78780664 CCCCTTCCCCAGACCTTGCCTGG - Intergenic
1072967109 10:99983086-99983108 TCTCTTTCCCAGCTCTTCCCAGG - Intronic
1072967344 10:99985486-99985508 CCCCTTTCCCAGCTCTTCCCAGG - Intronic
1073434514 10:103508111-103508133 CCACTTTCCCAGCTGTTGCCTGG - Intronic
1073445445 10:103577611-103577633 CCACTGTCCCCGCTCTTGTCGGG - Intronic
1073958418 10:108898243-108898265 TCACTTATCCAGCTCTCCCCAGG - Intergenic
1074010623 10:109475229-109475251 CCAGTTACCCAACTCTTTCTTGG + Intergenic
1074103630 10:110373391-110373413 GCATTTTCCCAGCACTTGCCAGG + Intergenic
1075639133 10:124051724-124051746 TCAATTACCCAGCCCTTGCTTGG + Intronic
1077070097 11:665836-665858 CCACTTTGTCAGCTCTGGCCAGG - Intronic
1077130682 11:970865-970887 CCATCTCCCCAGCCCTTGCCGGG + Intronic
1078669462 11:13352093-13352115 TCCCTTCCCCAGCTCATGCCTGG - Intronic
1083627498 11:64079091-64079113 CCACTGCACCATCTCTTGCCAGG - Intronic
1083654015 11:64220355-64220377 CCCCTGCCCCAGCTCCTGCCCGG - Intronic
1083951475 11:65959018-65959040 CCACTCAGCCAGCTCTTCACAGG - Intronic
1084564076 11:69919824-69919846 CCAGCCATCCAGCTCTTGCCTGG + Intergenic
1084778347 11:71392206-71392228 CCACCTAACCTGCTGTTGCCTGG + Intergenic
1085397680 11:76215147-76215169 CCCCTTACCCCACCCTTGCCTGG - Intergenic
1089324395 11:117647433-117647455 TCACTTAGCCAGCCCTTCCCAGG + Intronic
1089691423 11:120189054-120189076 CCACTTCCCCGGCACTTCCCTGG - Intergenic
1090158861 11:124470425-124470447 CCATTTTCCAAGCTCTTGTCTGG - Intergenic
1092089761 12:5794923-5794945 CCTCTAACCCAGCTGTGGCCTGG + Intronic
1095443637 12:42263102-42263124 CCTTTTACCCAGCTCTAACCAGG + Intronic
1096078817 12:48820434-48820456 CCACTTCCCTTTCTCTTGCCTGG + Intronic
1096717815 12:53501561-53501583 CCACTGCCCCAGTGCTTGCCGGG - Intronic
1097287108 12:57886889-57886911 CCACTCTCCCAGCTCTGCCCTGG + Intergenic
1097706683 12:62876004-62876026 CCCTTCACTCAGCTCTTGCCTGG + Intronic
1099450707 12:82803296-82803318 CCTCTAGCCCAGCTCCTGCCTGG - Intronic
1103995139 12:124824776-124824798 CCAGCTTCCCAGCTCCTGCCAGG + Intronic
1106224026 13:27771633-27771655 CCAATTAATCAGCTCTTGTCAGG + Intergenic
1107996344 13:45864796-45864818 CCCCTGACCCAGCTCTTCACAGG - Intergenic
1109509488 13:63351358-63351380 GCAGTTACTCAGCTCTTTCCTGG + Intergenic
1119325974 14:73759755-73759777 CCACTTACCCAGCTCTTGCCCGG + Exonic
1122180855 14:99953559-99953581 GCTCTTACCCACCCCTTGCCAGG + Intergenic
1122307668 14:100776109-100776131 CCCCTCACCCTCCTCTTGCCGGG - Intergenic
1122662903 14:103309826-103309848 GCCCTTACCCAGCTCCAGCCAGG + Intergenic
1125598871 15:40904714-40904736 CCGCCTTCCCAGCTCCTGCCTGG + Intergenic
1126894954 15:53247908-53247930 TCACTCACCCAGCTGTTTCCTGG - Intergenic
1127813262 15:62582695-62582717 CCACTTCCTCACCTCCTGCCTGG - Intronic
1129082131 15:73051554-73051576 CCACTTCCTCAGCTCGTGCGGGG - Intergenic
1129194679 15:73956743-73956765 CCCATTTCCCAGCTCCTGCCAGG + Intergenic
1131495555 15:92907542-92907564 ACTCATACCTAGCTCTTGCCAGG - Intronic
1132654401 16:1035885-1035907 CCACTCACTCAGCTCCTGACAGG - Intergenic
1137002006 16:35237299-35237321 CCAGTTACCCAGCATGTGCCAGG + Intergenic
1137580354 16:49630115-49630137 CGACTTACCTAGCTCTTCCCAGG - Intronic
1137840511 16:51636650-51636672 CCACTTACTCTTCTCTTCCCTGG - Intergenic
1138203371 16:55106442-55106464 CCAAATACACAGCTCTAGCCCGG - Intergenic
1138564657 16:57824329-57824351 CCACTGGCCCAGCTCTTGCTGGG - Intronic
1139422583 16:66857669-66857691 CCACTTACCCGGGTCATACCTGG + Intronic
1139491268 16:67287252-67287274 CCACTTCCCGAGCTTTTCCCAGG - Intronic
1142283441 16:89161032-89161054 TCACGCCCCCAGCTCTTGCCGGG - Intergenic
1142582724 17:952111-952133 ACAGTTACCCACCTCCTGCCAGG + Intronic
1142608862 17:1096914-1096936 CCCCTTCCCCAGCTCTCTCCCGG - Intronic
1143330639 17:6132458-6132480 CCAATTGCCCAGCTCTGGTCAGG - Intergenic
1147586473 17:41656212-41656234 CCACCTGCCCAGCTCATGACAGG - Intergenic
1148135493 17:45289162-45289184 CCTCGTCCCCAGCACTTGCCTGG - Intronic
1148463872 17:47852894-47852916 CCATTTACCCGGCGCTTACCAGG - Intronic
1148839238 17:50484174-50484196 CCTCTCAGCCAGCTCTAGCCAGG - Intronic
1149638030 17:58185761-58185783 CCACTGACCCAGGGCTGGCCTGG + Intergenic
1150805413 17:68314993-68315015 ACCCTTACCAAGCTCTTGCAAGG + Intronic
1151185082 17:72357977-72357999 CCACTTACCTGCCTCTTGTCTGG - Intergenic
1151413805 17:73948392-73948414 CCACCTGCTCAGCTATTGCCTGG + Intergenic
1151884645 17:76916369-76916391 CGCCTTTCCCAGCTCTGGCCTGG + Intronic
1152534331 17:80941557-80941579 CCACTGAGCCAGCTCTGGCTGGG + Intronic
1153294183 18:3530116-3530138 CCACCCACCCAGCTCCTGGCTGG - Intronic
1153691515 18:7599464-7599486 CCACTATCCCAGCTTTTGCTGGG + Intronic
1157576366 18:48746513-48746535 CCACCTCTCTAGCTCTTGCCTGG + Intronic
1160919251 19:1512176-1512198 CCTCTTCCCCAGCTGGTGCCCGG - Intronic
1161234374 19:3190566-3190588 CCACAGACGCAGCTCTTCCCGGG - Intronic
1161842826 19:6693264-6693286 CCACTCAGCCAGCGCTTGCCTGG + Intronic
1162335604 19:10058460-10058482 CCAGGTACCCAGCTCTGGGCTGG - Intergenic
1162835243 19:13312622-13312644 TCATTTCTCCAGCTCTTGCCTGG - Intronic
1164708512 19:30337845-30337867 ACACTTACTGAGCTCTTGCTAGG - Intronic
1165245758 19:34497648-34497670 CCACTTGCTCTGCTCTTGCTGGG - Intronic
1166117768 19:40666530-40666552 CCACTGACTCAGCACCTGCCAGG - Exonic
1166388363 19:42394973-42394995 CCACTCATCCAGCTCCTACCAGG - Intergenic
1167470349 19:49672294-49672316 ACACTTGACCAGCTCCTGCCAGG - Intronic
1168241007 19:55088861-55088883 CCACTTTGCCACCTCCTGCCTGG + Intergenic
1202676391 1_KI270711v1_random:10727-10749 TCACTGACCCATCCCTTGCCTGG + Intergenic
927217655 2:20677438-20677460 CCACTTGCCCACCTCCTGCCTGG - Intergenic
929396320 2:41527199-41527221 CCAGATACCCAGACCTTGCCTGG + Intergenic
930384648 2:50678801-50678823 CTACTCCCCCACCTCTTGCCTGG - Intronic
931657726 2:64524850-64524872 CCACTTACCCGGCCGGTGCCCGG - Intronic
932131279 2:69189616-69189638 CCACCTCCACAGCTCCTGCCTGG - Intronic
932775689 2:74527041-74527063 TCAGTTTCCCAGCTCTGGCCCGG - Exonic
935932744 2:108146511-108146533 CCACTTACCCAGAGCATACCTGG + Intergenic
936096573 2:109534865-109534887 CAAATTACCCAGCTCTAGTCAGG - Intergenic
936889549 2:117353306-117353328 CCACTTGCCCAGCTCATACTTGG + Intergenic
939771231 2:146322038-146322060 ATACTTGCCCAGATCTTGCCAGG + Intergenic
942913059 2:181269470-181269492 CCATTTACCCAGCACCTGCCAGG - Intergenic
943300215 2:186188845-186188867 CCACTAGCCCAGCTCTTCCCTGG - Intergenic
946745639 2:222842921-222842943 CCACATACCCATCTCTTTGCTGG + Intergenic
947800533 2:232926780-232926802 CTATTTGCCCAGCTCTTGTCTGG - Intronic
948117702 2:235505786-235505808 CCGCCTACCCCGCTCTTCCCAGG - Intronic
948256635 2:236573484-236573506 CCACTGTCCCAGCTCTTGTCTGG + Intronic
949044825 2:241867555-241867577 CCACGTAAGCAGCTCTTGCAGGG + Intergenic
1168773703 20:431932-431954 CCACTCTCCCCTCTCTTGCCAGG + Intergenic
1169943880 20:10967812-10967834 CCACTTCTCCTCCTCTTGCCAGG - Intergenic
1170363841 20:15578483-15578505 CCATTTACTGAGCTCTTGCCAGG - Intronic
1170563113 20:17574445-17574467 ACACTTACCCCTCTCTTTCCTGG + Intronic
1170958246 20:21001416-21001438 TCACTCACACAGCTGTTGCCTGG - Intergenic
1172354244 20:34268794-34268816 AGACTTACCTGGCTCTTGCCTGG - Intronic
1178404088 21:32310590-32310612 CCACTGCCCCAGCACTTCCCGGG + Intronic
1178796385 21:35748372-35748394 CCTCTAACCTGGCTCTTGCCAGG - Intronic
1179923510 21:44520346-44520368 CCACTTTCCCAGCCCTCACCAGG - Intronic
1182455878 22:30450206-30450228 CCTCTCACCCAGCTCTTCCACGG + Intronic
1183345409 22:37304660-37304682 CCCTTAACCCACCTCTTGCCTGG + Intronic
1183508635 22:38222680-38222702 CCCCTTGCCCTGCTTTTGCCCGG - Intronic
1183675734 22:39297831-39297853 CCCCTTTCCCAGCTCCTCCCTGG + Intergenic
1185070000 22:48651000-48651022 GCGCTCACCCAGCCCTTGCCAGG + Intronic
949915434 3:8959595-8959617 TCACTGCCCCAGCTCTTTCCAGG - Intronic
950860407 3:16142841-16142863 CCACTGAGGCAGCTGTTGCCTGG + Intergenic
951436867 3:22675778-22675800 CCCCTTACCCAGCTCCAGGCAGG - Intergenic
951480079 3:23151171-23151193 CCACTAACCCTGCTCTTTTCTGG - Intergenic
951983870 3:28596280-28596302 CCACTTATCCAGCACTTACTGGG + Intergenic
952238688 3:31507349-31507371 ACACTGACCCAGCTCCTGCTGGG - Intergenic
952824604 3:37514472-37514494 CCACTTGCCCAGCTCTGCACTGG - Intronic
954030623 3:47817545-47817567 TCTCTTACCCAGCTCTTGGAGGG + Intronic
954377371 3:50202216-50202238 CCTCTTATCCAGCCCTTCCCCGG - Intergenic
954798139 3:53171947-53171969 CCCCTTACCCAGCTCCCTCCCGG - Intronic
956825570 3:72994689-72994711 GCACTTGGCCAGCACTTGCCAGG - Intronic
956864281 3:73353833-73353855 CCACTTACCCAGCCTGGGCCTGG + Intergenic
959429414 3:106234562-106234584 CCACCTAAACAGCTCTTCCCAGG + Intergenic
961186519 3:124919779-124919801 CCACTGACCCTTCTCTAGCCAGG + Intronic
961708404 3:128807715-128807737 CCACTGACCCAGTCCCTGCCTGG + Intronic
962243104 3:133767881-133767903 CCACCAACCCAGGACTTGCCAGG - Intronic
962478658 3:135779805-135779827 CCACATACACAGTTCTGGCCTGG + Intergenic
965531917 3:169779367-169779389 CCTCTGATCCAGCTCTTCCCCGG - Exonic
968506261 4:972736-972758 CCAGCTGCCCAGCTCTTGCTGGG - Intronic
968892069 4:3374733-3374755 CCTCGTCCCCATCTCTTGCCTGG + Intronic
969281786 4:6175648-6175670 CCACCTACCCAGCTCCACCCAGG + Intronic
969378931 4:6782237-6782259 CCACTTCCCCAGCGCGGGCCGGG + Intronic
969874432 4:10125317-10125339 CCACATACCTAGTGCTTGCCTGG + Intergenic
972343718 4:38175454-38175476 CCATTTAACCAGCTCTGGACTGG - Intergenic
973058358 4:45688533-45688555 TCACTCACCCAGCTGTTGGCAGG + Intergenic
973103487 4:46301673-46301695 CCACTTACTCAGCTCTAGGAAGG + Intronic
981418548 4:144521651-144521673 CCACATACCCTGTCCTTGCCTGG + Intergenic
984945953 4:184968955-184968977 GCACATACCCTGCACTTGCCAGG - Intergenic
985950494 5:3218621-3218643 GCAGTTCCCCAGATCTTGCCGGG + Intergenic
991356604 5:65775461-65775483 CAACTTACCCAGCTCTTGCCAGG + Intronic
992104050 5:73436111-73436133 CCACCTCCCCACCTGTTGCCCGG - Intergenic
992204556 5:74418672-74418694 GCACTTACCCAACTTTTCCCTGG + Intergenic
992769609 5:80035236-80035258 CCAGCTGCCCAGCTCTTCCCAGG + Intronic
999151421 5:149428823-149428845 CCACCTCTCCAGCTCTGGCCGGG - Intergenic
999269592 5:150289025-150289047 CCCCTTTCTCAGCTCCTGCCAGG - Intronic
1001295761 5:170497790-170497812 CCAGTTACCCAGATCCTGCAAGG - Intronic
1004265869 6:14148159-14148181 CCAGTTGCCCACTTCTTGCCAGG - Intergenic
1004265875 6:14148233-14148255 TCACTTACCCAGGTCTTTCTGGG + Intergenic
1005043909 6:21623903-21623925 CCACTGACCCAGTTCTCACCAGG + Intergenic
1005273185 6:24187785-24187807 ACACTTATCCAGAGCTTGCCAGG + Intronic
1005967128 6:30734671-30734693 CCCCTTTGTCAGCTCTTGCCAGG + Intronic
1006260592 6:32865942-32865964 CGAGTCACCCAGCTTTTGCCTGG - Intergenic
1007576017 6:42925567-42925589 CCACTTGCCCAGCACAGGCCTGG + Exonic
1007775293 6:44221671-44221693 CAACTTACACAGGCCTTGCCTGG - Intronic
1010273954 6:73948162-73948184 CCACCTGCCCAGCTCATGGCTGG - Intergenic
1014212767 6:118723497-118723519 CCATTTCCCCAGCTCTTCCAAGG + Intergenic
1016307414 6:142698272-142698294 CCACTGAGCCAGCTCTTGCCTGG - Intergenic
1017261808 6:152396146-152396168 CCACTTTCCCTTCTCTTCCCAGG - Intronic
1017718999 6:157232155-157232177 CCCCTTCCCCAGCTCTGGCCAGG - Intergenic
1019349013 7:544499-544521 CCCCAGACCCAGCCCTTGCCTGG + Intergenic
1020566657 7:9806175-9806197 TCACATACTTAGCTCTTGCCAGG + Intergenic
1021585358 7:22201970-22201992 CCACTTATCCATCATTTGCCAGG - Intronic
1024025637 7:45408014-45408036 CCACAGGCCCTGCTCTTGCCTGG + Intergenic
1024855711 7:53776488-53776510 CAACTAACACAGCTGTTGCCAGG + Intergenic
1029264192 7:99325688-99325710 CCGCTTCGCCAGCACTTGCCAGG + Intergenic
1031021688 7:116635651-116635673 CCACTCACGCAGCCCTTGCCTGG + Intergenic
1032238422 7:130143001-130143023 CCATTTACCCAGCTCTCTCCAGG + Intergenic
1034348054 7:150399009-150399031 CCCCACACCCAGTTCTTGCCAGG + Intronic
1038492596 8:27981506-27981528 CCCCTCACCCACCTCCTGCCGGG + Intronic
1041036125 8:53792441-53792463 TCACTCACTCAGCCCTTGCCAGG + Intronic
1041456502 8:58066503-58066525 ACACTTACTCAGCTGTGGCCTGG - Intronic
1041457540 8:58076584-58076606 CCACTTCCTTAGCTCTTTCCTGG - Intronic
1041672713 8:60508681-60508703 TCACTCACCCAGCTGTTGGCAGG - Intergenic
1042026188 8:64426467-64426489 CAACTTAACCAGCTCTTCCTGGG - Intergenic
1045435450 8:102158875-102158897 CCACATACCCTGTTCTTGTCTGG + Intergenic
1052287733 9:26805915-26805937 CCACGGACCCTGCTCTTTCCCGG + Intergenic
1059943310 9:119379468-119379490 CCTCTTGTCCACCTCTTGCCTGG + Intergenic
1061376254 9:130226490-130226512 GCACTCACCCAGCTCCAGCCTGG - Exonic
1186875354 X:13811084-13811106 CCATTTTCCCATTTCTTGCCAGG - Intronic
1190759330 X:53426555-53426577 CCTCTTCCCAAGCTCTTCCCAGG - Intronic
1192941503 X:75917661-75917683 ACACTTACCCTGCTGGTGCCTGG + Intergenic
1197753478 X:129980634-129980656 CCACCCACCCCGCCCTTGCCTGG - Intergenic
1198163287 X:134028483-134028505 TCACTGACCCAGCTATTCCCTGG - Intergenic
1199659641 X:150036034-150036056 CTACCTACCCACCTCTTCCCTGG - Intergenic
1199695175 X:150338851-150338873 GCACTTTTACAGCTCTTGCCAGG + Intergenic