ID: 1119326525

View in Genome Browser
Species Human (GRCh38)
Location 14:73762795-73762817
Sequence CAGTTTGTAAAGAGGGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119326525_1119326530 11 Left 1119326525 14:73762795-73762817 CCCTCAACCCTCTTTACAAACTG 0: 1
1: 0
2: 1
3: 17
4: 165
Right 1119326530 14:73762829-73762851 AGTACAGAGCTCCAGTTACCAGG 0: 1
1: 0
2: 4
3: 18
4: 255
1119326525_1119326531 12 Left 1119326525 14:73762795-73762817 CCCTCAACCCTCTTTACAAACTG 0: 1
1: 0
2: 1
3: 17
4: 165
Right 1119326531 14:73762830-73762852 GTACAGAGCTCCAGTTACCAGGG 0: 1
1: 0
2: 3
3: 8
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119326525 Original CRISPR CAGTTTGTAAAGAGGGTTGA GGG (reversed) Intronic
902711423 1:18242663-18242685 CATAGAGTAAAGAGGGTTGAAGG - Intronic
903475477 1:23616428-23616450 CAGTTTACAATGAGGCTTGAGGG - Intronic
905957014 1:42005788-42005810 CAATTTTTAAACATGGTTGAAGG - Intronic
906000012 1:42416579-42416601 CAGTTTCTAAAGAGGGTTCTAGG + Exonic
906201951 1:43966175-43966197 CAGTTTGTGAACAGGGTAGCAGG - Intronic
910183130 1:84506552-84506574 CAGTTTGTGGGAAGGGTTGAGGG + Exonic
911125747 1:94339628-94339650 CAGTTTGCAAAGAGGAGAGATGG - Intergenic
911133415 1:94414500-94414522 CAGTGTGTAGAGTGGGCTGAAGG - Intergenic
911688069 1:100800237-100800259 CAATTTGTAAAGAGGCTTGATGG + Intergenic
912259738 1:108098439-108098461 CAGTTTGTAAAGAATGTTTATGG + Intergenic
915278290 1:154804888-154804910 CAGTGTGTGCAGAGGGTTGGAGG - Intronic
917568402 1:176235895-176235917 CAGTATGGGAAGAGGGGTGATGG + Intergenic
917763375 1:178189312-178189334 CCATTTGTAAATAGGGTTGTAGG + Intronic
918449849 1:184647619-184647641 CAGTTTATAGAGAAGGGTGAAGG - Intergenic
920949439 1:210558505-210558527 CAGTTTGTAATGATTGTAGAGGG + Intronic
924064062 1:240206202-240206224 CAATTTATAAAGACGGCTGATGG - Intronic
924229914 1:241954602-241954624 AAGTTTGGAAGGAGAGTTGAGGG + Intergenic
1067532436 10:47083955-47083977 CAGTTTCTTAAGATGATTGAGGG + Intergenic
1069138232 10:64792109-64792131 GTGTTTTTAAAGAGGGTTTATGG - Intergenic
1072434245 10:95400974-95400996 CAGATTGCACAGAGGGTTGAAGG + Intronic
1073893426 10:108125556-108125578 AAGTTTGTTATGAGGGATGATGG - Intergenic
1074763943 10:116686880-116686902 CAGTGTGGGAAGAGGGATGAGGG - Intronic
1075279519 10:121127745-121127767 CAGTTTCTAATGAGAGTGGATGG - Intergenic
1076062049 10:127420521-127420543 CACTGTGTAAAGAGAGTTGAGGG + Intronic
1080147482 11:29004864-29004886 CAGTTTGTAAAGTTGGTTAATGG + Intergenic
1082125705 11:48429035-48429057 CAGTATGTAAAATGGATTGAAGG - Intergenic
1082559324 11:54600065-54600087 CAGTATGTAAAATGGATTGAAGG - Intergenic
1087532270 11:99398929-99398951 GAGTTTGTTAAGTGGGGTGAAGG - Intronic
1088446706 11:109938133-109938155 CAGTATGGAAAGTGGCTTGAAGG - Intergenic
1089737325 11:120558757-120558779 TAGTTTATAGAGAGGGTTGGGGG + Intronic
1089893666 11:121906066-121906088 CAGATCGTAAAGAGCCTTGAAGG - Intergenic
1093189889 12:16061694-16061716 CAATTTGGAGAGAGGATTGAGGG + Intergenic
1093927148 12:24920401-24920423 CAGTTTGCCAAGAGGATTTATGG - Intronic
1098052220 12:66466291-66466313 CAGATTGTAAACATGCTTGAAGG + Intronic
1098277949 12:68832211-68832233 CAGTTTGTGAAGGGAGTTAAAGG + Intronic
1101296352 12:103427021-103427043 CAGTTTCTTCAGAGTGTTGATGG - Intronic
1107010852 13:35669529-35669551 CTGTTTTTAAAGAAGGTTTAAGG + Intronic
1107147032 13:37070299-37070321 CAGGCTGTTAAGAGGGTAGAAGG + Intergenic
1107825287 13:44323961-44323983 CAGCTTGCAAAGAGGGAAGAGGG - Intergenic
1108624995 13:52219056-52219078 CAGTTTGTAAATCGAGTAGAAGG + Intergenic
1108661057 13:52587361-52587383 CAGTTTGTAAATCGAGTAGAAGG - Intergenic
1109373063 13:61449537-61449559 CAGTTTGTCAGGAGGATTGTTGG + Intergenic
1110676861 13:78258444-78258466 AAGTCTGTGAAGAGAGTTGAAGG + Intergenic
1110745930 13:79053509-79053531 CAGATTGTGAAGAGCTTTGAAGG - Intergenic
1115710749 14:36048562-36048584 CACTTTGTACATAGAGTTGATGG + Intergenic
1115957083 14:38793581-38793603 CAGATTGTGTAGAGGCTTGAAGG + Intergenic
1116449256 14:45046849-45046871 CAGTTTGTAAATATTCTTGAGGG + Intronic
1118082687 14:62379817-62379839 GAGTTAGGAAAGAGGGTTAAAGG + Intergenic
1119326525 14:73762795-73762817 CAGTTTGTAAAGAGGGTTGAGGG - Intronic
1120948868 14:90022639-90022661 CAGTCTGTAAAAAGGGTTGTTGG + Intronic
1121395882 14:93622800-93622822 CAGTTTGTCCAGAATGTTGAAGG - Exonic
1121702269 14:95963546-95963568 CAGTTTATACAGAGGGCAGATGG + Intergenic
1121812934 14:96907530-96907552 CAGTTTGTTAGGAGGGTGGCTGG + Intronic
1122076694 14:99239738-99239760 CAGTTTGTAAACATGTTTTAGGG - Intronic
1126304742 15:47242639-47242661 CAGTTTGCTCAGGGGGTTGAAGG + Intronic
1128654097 15:69446620-69446642 AAGTTTGCAAAGAGAGTTGGTGG - Intronic
1129185929 15:73906469-73906491 CAGTTTGGAAAGAAGGATGAGGG + Intergenic
1129305134 15:74655020-74655042 CAGTTAGTAATGTGGTTTGAGGG + Intronic
1131973891 15:97921463-97921485 CAGCTGGTAAAGTGGGTTCATGG - Intergenic
1135204104 16:20467886-20467908 CAGTTTGTGAAGGAGGTTGCTGG - Intronic
1135524180 16:23201268-23201290 CAGTTTGAAAAGGGGGAAGAGGG - Intronic
1135882071 16:26267607-26267629 AAGTTTGCAAAGAAGCTTGAAGG - Intergenic
1141159482 16:81619575-81619597 CACTTTGGAGAGAGGGTTGTGGG + Intronic
1141368416 16:83465102-83465124 CATTTGGCAAAGAGGGTTGCGGG + Intronic
1145418425 17:22743680-22743702 CAGTTTGTAAACAGTGTTTTTGG + Intergenic
1145902956 17:28499852-28499874 CAGTCTGGAAAGAGGCTTGGAGG - Intronic
1150318135 17:64187219-64187241 CACTTTGTAAAGAATGTTCATGG + Intronic
1153064730 18:1033393-1033415 CAGTTTCTTTATAGGGTTGATGG + Intergenic
1153130519 18:1851053-1851075 CTGTTTGTAAGTATGGTTGATGG + Intergenic
1155750820 18:29420808-29420830 CATATTGTAAGGAGCGTTGAGGG + Intergenic
1155906926 18:31462917-31462939 GAGTTGGTAATTAGGGTTGAAGG - Intronic
1156729480 18:40173983-40174005 CAGTTTGGAAAGAGGGGGGAAGG - Intergenic
1157297255 18:46455317-46455339 TAGGTTGTAAAGGGTGTTGAGGG + Intronic
1158250678 18:55484074-55484096 CAGTTTGGAAAGAGGTTGAAAGG - Intronic
1159727870 18:71985139-71985161 CATTTTGTTAAGAGTTTTGATGG + Intergenic
1162864817 19:13537800-13537822 CAGTTTATAGACAGGCTTGAGGG - Intronic
1164534696 19:29076413-29076435 CAGTTTGGAAAGTGTGTTCAGGG - Intergenic
1165752717 19:38270590-38270612 CAGTTCCTAAAGAAGGTTGAGGG + Intronic
1165935206 19:39384744-39384766 CAGTTGGGAAGGTGGGTTGAGGG - Exonic
926812998 2:16772957-16772979 CATTATGTAAGGGGGGTTGAGGG - Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
927699695 2:25259950-25259972 CAGTTTCCAAACAGGGTTGGGGG - Intronic
928853322 2:35774957-35774979 CAGTTTATAAAGAGTGTTTGGGG + Intergenic
930440104 2:51393554-51393576 CAGTTTCTTCATAGGGTTGATGG - Intergenic
932577015 2:72968316-72968338 CAGTTTGTGTAGAGGGTGGAAGG - Intronic
933071126 2:77859110-77859132 TAGTTTGTAACAAGGGTTGATGG - Intergenic
937021980 2:118665527-118665549 CAGTATGTGAGGAGGGTTTAGGG - Intergenic
937391395 2:121490455-121490477 GATTTTGTAAAAAGGGTTGGGGG + Intronic
938967782 2:136403988-136404010 CAGTTTGGATGGAGGGTGGATGG - Intergenic
940084089 2:149838522-149838544 CAGTTTCTACATAGTGTTGATGG + Intergenic
940535876 2:154943671-154943693 GAGTTTGAAATGAGGGATGAGGG - Intergenic
944270670 2:197782568-197782590 CAATTTCTAGAGAGGGTTTAAGG - Intronic
946067701 2:217003392-217003414 CACTTTGTAAGGAGGGTGGCTGG - Intergenic
946579821 2:221116151-221116173 CAGTTAGCAAAGATGGATGAGGG + Intergenic
946790011 2:223291688-223291710 CAGTTTCTTAATAGTGTTGATGG + Intergenic
948343936 2:237279481-237279503 CAGTTTATAGAGAGGCTAGAAGG + Intergenic
1168852414 20:985738-985760 CAGTTTCTAAAGAGGATCTAAGG + Intronic
1169031831 20:2415567-2415589 CAGTTTGTATGGTGGTTTGATGG + Intronic
1170017667 20:11799887-11799909 CATTTTGTTAAGTGGGGTGAGGG + Intergenic
1170346477 20:15392564-15392586 CTGTTGGTAAAGAGGCATGATGG - Intronic
1174288346 20:49488537-49488559 AAGTTTGTAGAGAGGATTAAAGG - Intergenic
1175488151 20:59360290-59360312 AAGTTTGGAAGGAGGGTCGATGG - Intergenic
1177314625 21:19441695-19441717 AAGTTTGTAAAGAAAGTTGTAGG + Intergenic
1179631465 21:42681151-42681173 CATTCTGTAAATAGGGTTGATGG - Intronic
1183237845 22:36633014-36633036 CAGTTAGCAAAGAGGCTTGAAGG - Intronic
949649440 3:6138912-6138934 CTGTTTCTAAAGATAGTTGAAGG - Intergenic
950478324 3:13227976-13227998 CAGTTTCTAAACAGGGTGAAGGG + Intergenic
950762208 3:15241500-15241522 CAGTTTGTACTGGGGGTTGTTGG - Exonic
951062706 3:18228445-18228467 CAGCTTGGAAAGATTGTTGAGGG - Intronic
952002857 3:28807254-28807276 CTGTTTGGAAGGAGGTTTGAGGG - Intergenic
952089690 3:29869594-29869616 CAGTTTGTATTGAGGGTAAATGG - Intronic
952297576 3:32074735-32074757 CAGATTGTAATGGGGATTGATGG - Intronic
957965252 3:87313685-87313707 CAGTCTGTTAAGATGGTTGAGGG + Intergenic
959213179 3:103415237-103415259 CAGTTTGTTAACACTGTTGAAGG - Intergenic
959427970 3:106216990-106217012 TTATTTGTAAAGAGGATTGAGGG - Intergenic
960304454 3:116044027-116044049 CAATTGGTAAAGAGGGCTCATGG - Intronic
960372232 3:116854506-116854528 AAGTTTGTAATCATGGTTGAAGG - Intronic
960421969 3:117457627-117457649 CAGTGTGTAAGGAGGAATGAAGG + Intergenic
960591409 3:119369271-119369293 CAGTTGGCAAAGAGGGATGAGGG + Intronic
963743048 3:149098231-149098253 CAGCTTGTGAGGAGGGTGGAAGG - Intergenic
964332804 3:155622324-155622346 CAGTTTCTTAATAGTGTTGATGG - Intronic
965294962 3:166932810-166932832 CTATGTGTAAAGAGAGTTGATGG - Intergenic
965746962 3:171936021-171936043 GAGTTTGGAAAGAGGGTTACGGG + Intronic
967949747 3:194831701-194831723 CAGTGTGTCTAGAGGGTGGAAGG + Intergenic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
969063639 4:4460029-4460051 CAGTTTATAAAGAAGGATTAGGG - Intronic
972907309 4:43767288-43767310 CAGTATGTTAAGAAGTTTGAAGG - Intergenic
973990736 4:56404256-56404278 CAGTTCATCAAGAGTGTTGAGGG - Intronic
974121825 4:57647473-57647495 CATTTTGTTAAAGGGGTTGATGG - Intergenic
978441319 4:108737270-108737292 CACTTTGTGAAGAGGGTGGAGGG - Intergenic
978891943 4:113839808-113839830 CAGGTGGTAAAGAAGCTTGAAGG + Intergenic
981468124 4:145097725-145097747 CAGTTAGTAATGATGGTTGCAGG - Intronic
982326885 4:154137335-154137357 CAGGTGGTGGAGAGGGTTGAAGG - Intergenic
982352557 4:154431778-154431800 CTGTATGTAAAGAAGGCTGAAGG - Intronic
983035608 4:162861976-162861998 AAGTTTGAAAAGAGTGTTTACGG - Intergenic
983405470 4:167323976-167323998 CAATTTGGAAAGGGGGGTGAAGG - Intergenic
983633479 4:169874101-169874123 CAAATTGTAAAAAGGATTGAAGG - Intergenic
985234362 4:187856725-187856747 CAGATTGCAATGAGGGCTGAGGG + Intergenic
985636284 5:1037433-1037455 TATTTTGTAATGAGGGTTTAGGG + Intronic
985883120 5:2655899-2655921 CAGTTTGGAAGGAGAGATGATGG + Intergenic
987144117 5:14975177-14975199 GAGTTTGTAATGAGAGTAGATGG + Intergenic
988644340 5:33077723-33077745 GAGGTTTTAAAGAGGCTTGAAGG + Intergenic
990515019 5:56522953-56522975 AACTTTGTAAATAGGGTAGATGG + Intronic
990662454 5:58031936-58031958 CAGTTAGTCAAGTTGGTTGATGG - Intergenic
997142480 5:131397524-131397546 CAGATTGAAAAGAGGGAAGAAGG - Intronic
998912016 5:146970071-146970093 GAGGATGTAAAGAGGGTGGATGG - Intronic
1000186119 5:158859690-158859712 CAGTATGCACAGAGGCTTGAAGG - Intronic
1006308675 6:33241367-33241389 CAGATTGTAAATGGGGTTGGGGG + Intergenic
1008729774 6:54467359-54467381 CAGTTTGTAAAGATGGGTCAAGG - Intergenic
1010673265 6:78711985-78712007 GACTCTGTAAAGAGGGGTGACGG - Intergenic
1011201929 6:84846381-84846403 CAGATTGTAAAGAGTGGTGGGGG - Intergenic
1015516672 6:134089196-134089218 CATTTTGATAAGAGGGGTGAGGG + Intergenic
1017922110 6:158881827-158881849 GAGGTTGTAATGGGGGTTGATGG + Intronic
1018865168 6:167741383-167741405 CAGTTAGTAAAAAGGGATAAAGG - Intergenic
1018865172 6:167741431-167741453 CAGTTAGTAAAAAGGGATAAAGG - Intergenic
1020771530 7:12401632-12401654 CAGTTAATAAAAAGTGTTGATGG + Intronic
1022877845 7:34553152-34553174 CAGTATGGATCGAGGGTTGAGGG - Intergenic
1023001250 7:35810213-35810235 GAGTTTGTGAACAGAGTTGAAGG + Intronic
1025764675 7:64432102-64432124 CAGTTTGTAAGGAGTATTTACGG - Intergenic
1033459591 7:141533316-141533338 CAGTTTGTAAAGGGGGTCTGGGG - Intergenic
1034483523 7:151341693-151341715 CCGCTTGGAAAGAGGGTTGTGGG - Exonic
1042034675 8:64518914-64518936 CAGTTTGCAAACAGGATTTATGG - Intergenic
1043528004 8:81117370-81117392 CACCTTCTAGAGAGGGTTGATGG + Intergenic
1043574480 8:81642413-81642435 CAGTTTTTAAACAGGGTTCTTGG - Intergenic
1043587206 8:81783294-81783316 CAGATTGATAAGAGGGTGGAAGG + Intergenic
1045803418 8:106128096-106128118 CAGTTTGCACAGATGGTTAAGGG - Intergenic
1045979066 8:108162684-108162706 CAATTTTGAAAGATGGTTGAGGG + Intergenic
1052052493 9:23864684-23864706 CAGTTTTTTAATAGTGTTGATGG + Intergenic
1059059715 9:111022448-111022470 CAGTTTTAAAAGAGGGTGGGGGG + Intronic
1059589433 9:115642144-115642166 AAGTTTGTCAAAAGTGTTGAAGG + Intergenic
1060747443 9:126146762-126146784 CAGTTTGGAAGCAGAGTTGAGGG - Intergenic
1186389147 X:9141168-9141190 CACTTTGAAAAGAGGGAGGAAGG + Intronic
1186952728 X:14645260-14645282 CTGTATGTAAAGAGGGTTTGTGG - Intronic
1194959623 X:100220273-100220295 CAGGTGGTAAAGAGTGGTGAGGG + Intergenic
1195606592 X:106812537-106812559 CTGTTTGTAAACTGGATTGAGGG - Intronic
1195617573 X:106924918-106924940 AAGTTGGCAAAGAGGTTTGAGGG - Intronic
1196121566 X:112056693-112056715 CATTTTCCTAAGAGGGTTGAAGG + Intronic
1197895471 X:131309009-131309031 TAGTTTGTAAAGAGGGAGTAAGG + Intronic
1198174007 X:134136597-134136619 CTGTTTGGAATGAGGGTTAAAGG - Intergenic
1198765678 X:140077211-140077233 CATTTTGTAAAGAAGCTTGCTGG + Intergenic
1199109710 X:143916372-143916394 GAGTATGTATAGAGGGGTGAGGG - Intergenic
1199829225 X:151532337-151532359 CAGTATGCCAAGAGGGCTGAGGG + Intergenic
1199945583 X:152663790-152663812 CAGTTTTTAAATGGGGTTGTGGG + Intergenic
1201458872 Y:14201076-14201098 GAGGTTGTAAGGAGGGATGATGG + Intergenic