ID: 1119326625

View in Genome Browser
Species Human (GRCh38)
Location 14:73763544-73763566
Sequence CTCATTGGGGGAGGAACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 171}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119326625_1119326635 29 Left 1119326625 14:73763544-73763566 CCCACTGTTCCTCCCCCAATGAG 0: 1
1: 0
2: 1
3: 11
4: 171
Right 1119326635 14:73763596-73763618 AACCAACCTTTACCAGAGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 77
1119326625_1119326636 30 Left 1119326625 14:73763544-73763566 CCCACTGTTCCTCCCCCAATGAG 0: 1
1: 0
2: 1
3: 11
4: 171
Right 1119326636 14:73763597-73763619 ACCAACCTTTACCAGAGCCTGGG 0: 1
1: 0
2: 1
3: 7
4: 121
1119326625_1119326632 -9 Left 1119326625 14:73763544-73763566 CCCACTGTTCCTCCCCCAATGAG 0: 1
1: 0
2: 1
3: 11
4: 171
Right 1119326632 14:73763558-73763580 CCCAATGAGGCCAGCACACGTGG 0: 1
1: 0
2: 3
3: 12
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119326625 Original CRISPR CTCATTGGGGGAGGAACAGT GGG (reversed) Intronic
900208999 1:1444342-1444364 CCCATTGGGGAAGGAGCAGGGGG + Intergenic
901316717 1:8314831-8314853 CTCACTGTGGGAAGGACAGTTGG - Intergenic
902337277 1:15760802-15760824 CTCTCTGGGGGAGGAAGAGTGGG + Intronic
902744744 1:18466226-18466248 CTCATGGGGGGAAGAGCATTAGG + Intergenic
902976145 1:20089979-20090001 CTTGTTGGGGGAGGAGGAGTTGG + Intronic
904237824 1:29125399-29125421 CTTATTGGAGGAAGAGCAGTGGG - Intergenic
905136380 1:35803674-35803696 CTTTTTGGAGGGGGAACAGTAGG + Intergenic
905749565 1:40450347-40450369 CTCATTTGGGGAGGAGGAGGCGG + Intronic
908757084 1:67479168-67479190 CTGAGTGGTGGAGGAACAGGGGG - Intergenic
910596895 1:88990690-88990712 CTCATTGTGTAAGGAACTGTGGG + Intronic
912368341 1:109153009-109153031 CTCATGTGGGGAGGAGCAGGTGG + Intronic
912848796 1:113103456-113103478 CTCAGTGAGGGAGAGACAGTAGG - Intronic
914675426 1:149904231-149904253 CAGATTAGGGGAGGAACTGTGGG + Exonic
917046898 1:170870819-170870841 CTCTTTGAGGCAGGAACTGTTGG + Intergenic
920880716 1:209877980-209878002 CTGATTGGGGAAGGAGAAGTAGG + Intergenic
922994936 1:229948577-229948599 CTCATCTGGGGTGGAAGAGTCGG - Intergenic
924622033 1:245670625-245670647 CTCATTTGTGGATGAACAATTGG - Intronic
924947519 1:248856287-248856309 CTCATCTGGGGAGGAGCTGTAGG + Exonic
1064304212 10:14150790-14150812 CTCATTGGGAGAGGAGCGGGAGG - Intronic
1065380590 10:25086335-25086357 TTCATTGGTGAAGGAAAAGTTGG + Intergenic
1070523532 10:77275601-77275623 CTCACTAGGGGAGCAACAATTGG - Intronic
1071249592 10:83803437-83803459 CTCATTGAGGAAGGTAAAGTGGG + Intergenic
1071737626 10:88318849-88318871 GTCTTTGGGGAAGGAGCAGTTGG - Intronic
1074885074 10:117686851-117686873 ATCACTGAAGGAGGAACAGTGGG + Intergenic
1075221015 10:120584603-120584625 CTTATTGGGGGAAAAACACTTGG - Intronic
1076087201 10:127644138-127644160 CACATGGTGGGAGGAACAGAAGG - Intergenic
1078245018 11:9566240-9566262 CTCATTAGGGGAGGGAAAGGAGG - Intergenic
1079873710 11:25831419-25831441 GACAGTGGGGGAGGGACAGTGGG + Intergenic
1081667044 11:44922724-44922746 CTCATTGGAGGAGGGGCAGGAGG + Intronic
1084746294 11:71171989-71172011 CTCCTTGGGGCAGCAGCAGTAGG + Intronic
1085135384 11:74082682-74082704 CCCTTTGGGGGAGGGACAGGGGG - Intronic
1088505302 11:110521705-110521727 CTCACTGAGGGAAGATCAGTGGG - Intergenic
1089332780 11:117701527-117701549 CTCTTTGGAGGAGGAAGAGCTGG + Intronic
1091894093 12:4086555-4086577 CTCTTTGGGGTCTGAACAGTTGG + Intergenic
1093444686 12:19243218-19243240 CTCATTGGCTGTGGAAGAGTTGG + Intronic
1095115253 12:38344708-38344730 CTCTTAGGTGGAGGCACAGTGGG + Intergenic
1096737788 12:53669424-53669446 CTGTTTGGGGGAGAAACAATGGG - Intronic
1099401815 12:82210233-82210255 TTCTTTTGGGGATGAACAGTGGG + Intergenic
1105822330 13:24090598-24090620 CTAAGTGGGGTAGGGACAGTGGG - Intronic
1107685774 13:42896761-42896783 CTCAGTGGGGGAGGAAAGGTAGG - Intronic
1108112730 13:47093729-47093751 AAGATTGGAGGAGGAACAGTTGG - Intergenic
1108212726 13:48154726-48154748 CTCACTGGGGAAAGAGCAGTGGG + Intergenic
1109280002 13:60344987-60345009 CTCATGGTGGAAGGCACAGTGGG - Intergenic
1110732709 13:78897747-78897769 CTCATTAGAGGAGACACAGTTGG - Intergenic
1112297678 13:98202619-98202641 CTCAGTGGGGCAGGAGTAGTTGG + Intronic
1113611142 13:111645762-111645784 CTAATTGATGGAGGAGCAGTGGG + Intronic
1116430304 14:44838725-44838747 TTGATTGGGGGAGGAGGAGTAGG - Intergenic
1118338899 14:64879143-64879165 CTCTTTGGGAGAGGAAGACTAGG + Intronic
1119326625 14:73763544-73763566 CTCATTGGGGGAGGAACAGTGGG - Intronic
1119427252 14:74543798-74543820 CTCCTTGGTGAAGGACCAGTGGG + Intronic
1121302087 14:92880108-92880130 GCCATTTGGGGTGGAACAGTGGG + Intergenic
1121469334 14:94139737-94139759 CTCACTAGGGCAGGAACAATGGG - Intergenic
1122305286 14:100761986-100762008 CTATTTTGGAGAGGAACAGTTGG - Intergenic
1122466784 14:101939122-101939144 TTCATTGGGGGAAGCCCAGTGGG - Intergenic
1122706690 14:103626366-103626388 CACATTGGGGAAGGGACAGGTGG + Intronic
1124041648 15:26110990-26111012 CTCCTTGAAGGAGGGACAGTTGG - Intergenic
1125004752 15:34804789-34804811 GACATTGTGGCAGGAACAGTGGG + Intergenic
1128953178 15:71908906-71908928 CTAGTTGGGGGAGGATGAGTAGG - Intronic
1129483369 15:75844365-75844387 CTCGTTGACGGAGGAAAAGTTGG + Intronic
1129741423 15:77991452-77991474 CCCAGTGGGGGAGGACCAGATGG + Intronic
1129844240 15:78760955-78760977 CCCAGTGGGGGAGGACCAGATGG - Intronic
1130270964 15:82446723-82446745 CTCGTTGATGGAGGAAAAGTTGG + Intergenic
1130463305 15:84174046-84174068 CTCGTTGATGGAGGAAAAGTTGG + Exonic
1130474154 15:84248429-84248451 CTCGTTGATGGAGGAAAAGTTGG + Intergenic
1130481569 15:84362497-84362519 CTCGTTGATGGAGGAAAAGTTGG + Intergenic
1130489369 15:84420742-84420764 CTCGTTGATGGAGGAAAAGTTGG - Intergenic
1130500960 15:84499504-84499526 CTCGTTGATGGAGGAAAAGTTGG - Intergenic
1130980544 15:88809237-88809259 CTGCTTGGGGGAGGGGCAGTGGG + Intronic
1131151498 15:90050103-90050125 CTCCTGGGGGGAGGGACAGCTGG - Intronic
1131664832 15:94559068-94559090 CTGATTGGTGGAGCAACAGGGGG - Intergenic
1132186909 15:99808182-99808204 CTCGTTGACGGAGGAAAAGTTGG + Intergenic
1132428780 15:101744539-101744561 CTCGTTGACGGAGGAAAAGTTGG - Exonic
1140608565 16:76570599-76570621 ATCATTGCGGGAGGAAAAGGAGG - Intronic
1142292459 16:89199369-89199391 GTCACTGGGGGAGGGGCAGTGGG - Intronic
1142886665 17:2916998-2917020 CTCTTTGTGGGAGGAACAGCTGG + Intronic
1147314484 17:39613004-39613026 CTGATTGGGGGTGGGACAGGGGG - Intergenic
1147856136 17:43481586-43481608 CTCTTATGGGGAGGAAGAGTAGG + Intergenic
1148813607 17:50311000-50311022 GTCTTTGGGGGAGGGAGAGTTGG + Intergenic
1151527500 17:74681057-74681079 CTCCTTGGGGAATGAAGAGTGGG - Intronic
1151680543 17:75620539-75620561 CTCCTTGGAGAAGGAAAAGTCGG - Intergenic
1151768685 17:76145732-76145754 TTCATTGGGGCAGGAAGAGGTGG + Intronic
1153380109 18:4428649-4428671 CTCATGGTGGGAGGCAAAGTGGG - Intronic
1153778358 18:8473435-8473457 CTCATGGTGGGAGGCAAAGTGGG + Intergenic
1155276008 18:24188112-24188134 CTCATTGAGGAAGGAATAGATGG + Intronic
1157126305 18:44959695-44959717 CTCAGTGGGGGAGGAGAGGTGGG + Intronic
1157382011 18:47227103-47227125 CACATTTGGGGAGCAGCAGTTGG - Intronic
1161466351 19:4432820-4432842 GTCATTTGGGTAGGAACAGCAGG + Intronic
1162020761 19:7867383-7867405 TTCATTGGGGGAGGAAGGGCAGG + Intergenic
1162575204 19:11495231-11495253 CTCAGTGAGGGAGGCTCAGTTGG - Intronic
1163727692 19:18932110-18932132 CTCCGTGGGCGAGGTACAGTGGG - Exonic
1165193753 19:34085331-34085353 CTCACTGTGGGGAGAACAGTGGG - Intergenic
1165311700 19:35032435-35032457 ATCATTGAGGGGGGAACAGATGG + Intronic
1167476502 19:49704647-49704669 CCTGTTGGGGGAGGGACAGTAGG - Intronic
928412368 2:31065013-31065035 CTCCTTGGGTGATGAAAAGTGGG + Intronic
929133622 2:38602597-38602619 CTCCCTGGGGGAGGAAGAGGAGG + Exonic
933245200 2:79967245-79967267 ATGGTTGGGGTAGGAACAGTTGG - Intronic
933296567 2:80497755-80497777 GTCACAGGGGAAGGAACAGTGGG + Intronic
933775349 2:85768224-85768246 CTCATTGGGGTAGGAAGGGCTGG - Intronic
939478529 2:142717631-142717653 ATCATTGCTGGAAGAACAGTGGG + Intergenic
941866772 2:170343559-170343581 CTCCATGGGGAAGGAACAGTGGG + Intronic
943514014 2:188862457-188862479 CTCCTTGAGGGAGGAGCAGCAGG + Intergenic
946131163 2:217608078-217608100 CTCCTCTGGGGAGGAGCAGTCGG - Intronic
1169169558 20:3453610-3453632 TTCATTGTGGTAGGCACAGTTGG - Intergenic
1173000561 20:39102459-39102481 CTCAGTAGGGGAGGAAGAGACGG - Intergenic
1173596496 20:44261990-44262012 CATATTGGGACAGGAACAGTTGG + Intronic
1173859357 20:46272262-46272284 CAAATTTGGGGAGGAAGAGTTGG + Intronic
1175042774 20:56071494-56071516 CTAATTGGTGGAGGTAGAGTGGG + Intergenic
1175817480 20:61891030-61891052 CTCATTTTGGAAGGAAGAGTGGG + Intronic
1181298935 22:21865892-21865914 CACATTGAGGGAGGAAAAGATGG - Intronic
1184805746 22:46793908-46793930 CTCACTGTGGGAGAATCAGTGGG + Intronic
949438921 3:4059352-4059374 CTCATAGGAGGAGGAAAAGAAGG + Intronic
950453719 3:13080191-13080213 CTCATGGGGGAAGGATTAGTGGG + Intergenic
952730112 3:36629725-36629747 CTCATCGGTGGAGGTACAGGAGG - Intergenic
953631467 3:44621601-44621623 CTCATGGGGGAAGGCAAAGTGGG - Intronic
954404404 3:50337482-50337504 CTCATTGGGGCAGGAACGCCGGG + Intronic
960729259 3:120707310-120707332 CTCATTGAGGAAGGAAGAGTGGG - Intronic
961171217 3:124799109-124799131 CTCTGTGGGGTAGGAAGAGTAGG + Intronic
961368311 3:126415084-126415106 CTCATTGGAGAAGATACAGTAGG - Intronic
964076105 3:152694055-152694077 CTCATTGGTTGAGGAGCATTTGG - Intergenic
964747737 3:160027465-160027487 CTAGTTGGGTAAGGAACAGTGGG + Intronic
968065006 3:195753693-195753715 CTCAGAGCGGGAGGAACAGATGG + Intronic
969939584 4:10717273-10717295 CTCATTGGGGTAGTATCAGAGGG + Intergenic
970898940 4:21136256-21136278 GTCATTAGGTGGGGAACAGTAGG - Intronic
974092456 4:57326117-57326139 TCCATTGGAGGAGGAATAGTTGG + Intergenic
978622862 4:110651727-110651749 CTCTTTGGTGGAGGCACGGTGGG - Intergenic
979743418 4:124179627-124179649 CACAGAGGGGGAGAAACAGTAGG - Intergenic
983826874 4:172273440-172273462 TTCATTGGTGGAGGGGCAGTCGG + Intronic
983829116 4:172302367-172302389 GACAGTGGGGGAAGAACAGTGGG - Intronic
984888908 4:184474205-184474227 CTGATTTTTGGAGGAACAGTCGG - Intronic
987320263 5:16762436-16762458 TTCAATGTGGGAGGCACAGTTGG + Intronic
987758570 5:22128697-22128719 CTCAGTGGGGGAGAAGAAGTGGG - Intronic
989161222 5:38393659-38393681 GTCCTTGCGGGAGGAAGAGTTGG + Intronic
993550874 5:89272439-89272461 ATTATTGGGGGAGGAAGAGAGGG - Intergenic
997263072 5:132478449-132478471 CTCCTTGGGTGAGGAATGGTGGG + Intergenic
997691887 5:135832814-135832836 ATCATTGGGGAAGGAACTGAGGG + Intergenic
997791388 5:136765658-136765680 ATCATAGGGGGAGGAACAGTGGG + Intergenic
1001616798 5:173049297-173049319 CTCTCTGGGTGAGGAACAGAGGG - Intergenic
1001796382 5:174505632-174505654 CACCTTGGGGGAGGAAGAGTTGG - Intergenic
1002639725 5:180625048-180625070 GTCAGTGGGGGAGGCTCAGTAGG - Intronic
1003515366 6:6813528-6813550 CCCTTTGGGGAAGGAACAGTGGG + Intergenic
1006302917 6:33203601-33203623 CTCACTGAAGGAGGAGCAGTGGG + Exonic
1007490537 6:42217981-42218003 CTTTTTGGGGGCGGGACAGTTGG + Intergenic
1010123751 6:72409702-72409724 CTCATGGTGGGAGGCAAAGTGGG - Intergenic
1013298596 6:108781754-108781776 CTCCTTGGGTGAGGAGGAGTGGG + Intergenic
1017738259 6:157382077-157382099 CTCCATGGGGGAGGAGCTGTGGG - Exonic
1019634325 7:2067404-2067426 CTTCCTGGGGGAGGAAGAGTGGG - Intronic
1020008847 7:4797448-4797470 CTCTTTGTGGGAGGAACTGTTGG + Intronic
1020360517 7:7322424-7322446 ATCATTAGGGGAGGAATGGTGGG + Intergenic
1020795623 7:12675774-12675796 CTCATTGGTGGTTGGACAGTGGG + Intergenic
1023083410 7:36546567-36546589 CTCTTTGGGAAAGGAAAAGTAGG + Intronic
1023355548 7:39363667-39363689 CTCAGTGAGGGAGGAAAAGGGGG + Intronic
1023609039 7:41955995-41956017 CTCAGCGGGGGAGGAAGAGAAGG + Intergenic
1032560184 7:132882778-132882800 GTCATTGGGTGAGGAAAAGCAGG + Intronic
1037931475 8:22882922-22882944 TTCATCGTGGGAGGAACAGGTGG - Intronic
1038870908 8:31491295-31491317 GTCAGTGGGGGCAGAACAGTGGG - Intergenic
1039011245 8:33095837-33095859 CTCATTGCGGTAGGAACACTTGG - Intergenic
1040427624 8:47304628-47304650 CTCATGGTGGGAGGCAAAGTGGG - Intronic
1041454376 8:58041714-58041736 CTGATTGGTGGAGGAAGAATAGG + Intronic
1042089436 8:65142882-65142904 CTTCTTGGGGGAGTGACAGTTGG - Intergenic
1042516235 8:69662422-69662444 CTCATTTGGGTAGGGACAGTTGG - Intergenic
1043277667 8:78420270-78420292 CAAATGGGGGCAGGAACAGTGGG - Intergenic
1043540836 8:81260405-81260427 CTCCTTGGGAGAGGAATACTGGG - Intergenic
1044121110 8:88397304-88397326 CTCTTTGGTGGAGGGAAAGTTGG - Intergenic
1046349234 8:112984818-112984840 CTCATTGGTGTAGAAAAAGTAGG - Intronic
1047091624 8:121581748-121581770 CTCATTGGGTGACGGACACTTGG + Intergenic
1047885477 8:129245470-129245492 ATGATTGGGGAAGGAAGAGTAGG + Intergenic
1051596283 9:18827116-18827138 CTCAGTGGGGGAAGAACAGCAGG - Intronic
1051938227 9:22470773-22470795 TTAATTGGGGGAAGAACAGAAGG + Intergenic
1055891033 9:81123232-81123254 TTCAGTGGGGGAGGTACAGCTGG - Intergenic
1056525765 9:87441616-87441638 CTCATTGTGGAAGGCAAAGTGGG + Intergenic
1057724168 9:97556467-97556489 CTCACTGGAGGAAGAAGAGTAGG + Intronic
1058073094 9:100621391-100621413 CTCATTGGATGAGGCACAATTGG + Intergenic
1058420072 9:104824959-104824981 CTCCTTAGGGGAGGATCAGAAGG + Intronic
1060767134 9:126303448-126303470 CACATGGAGGGAGAAACAGTGGG + Intergenic
1061267025 9:129512155-129512177 CTCTTTGGAGGAGGCACAGGAGG + Intergenic
1062163659 9:135094237-135094259 CTCATGGGGGGAGTGACACTGGG - Intronic
1187707286 X:22021136-22021158 CTTACTGGGGGAGGAAAAGAGGG - Intergenic
1189547403 X:42055966-42055988 CTCATGGAGGAAGGAAAAGTGGG + Intergenic
1191111970 X:56811352-56811374 CACCTGGGGGAAGGAACAGTTGG - Intergenic
1197723052 X:129758055-129758077 CTCATTGAGGAAGGAAGTGTGGG + Intronic
1202371885 Y:24204566-24204588 CTCGTTGATGGAGGAAAAGTTGG - Intergenic
1202376764 Y:24245623-24245645 CTCGTTGGTGGAGGAGAAGTTGG - Intergenic
1202494016 Y:25424498-25424520 CTCGTTGGTGGAGGAGAAGTTGG + Intergenic
1202498900 Y:25465550-25465572 CTCGTTGATGGAGGAAAAGTTGG + Intergenic