ID: 1119327305

View in Genome Browser
Species Human (GRCh38)
Location 14:73768286-73768308
Sequence AAGGTTAAACAGCTCTGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 223}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119327299_1119327305 18 Left 1119327299 14:73768245-73768267 CCATTTTTCCCATTTTATAGATA 0: 1
1: 3
2: 24
3: 178
4: 1159
Right 1119327305 14:73768286-73768308 AAGGTTAAACAGCTCTGCCAAGG 0: 1
1: 0
2: 1
3: 24
4: 223
1119327298_1119327305 30 Left 1119327298 14:73768233-73768255 CCTTGAAGGAAGCCATTTTTCCC 0: 1
1: 0
2: 2
3: 24
4: 244
Right 1119327305 14:73768286-73768308 AAGGTTAAACAGCTCTGCCAAGG 0: 1
1: 0
2: 1
3: 24
4: 223
1119327301_1119327305 10 Left 1119327301 14:73768253-73768275 CCCATTTTATAGATAAGGAAGCT 0: 4
1: 122
2: 906
3: 3910
4: 10074
Right 1119327305 14:73768286-73768308 AAGGTTAAACAGCTCTGCCAAGG 0: 1
1: 0
2: 1
3: 24
4: 223
1119327302_1119327305 9 Left 1119327302 14:73768254-73768276 CCATTTTATAGATAAGGAAGCTG 0: 9
1: 131
2: 1002
3: 4345
4: 11155
Right 1119327305 14:73768286-73768308 AAGGTTAAACAGCTCTGCCAAGG 0: 1
1: 0
2: 1
3: 24
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119327305 Original CRISPR AAGGTTAAACAGCTCTGCCA AGG Intronic
902531150 1:17091488-17091510 AAGGTCAGTCAGCTCGGCCAGGG - Intronic
905476227 1:38230135-38230157 CAGTTTAAGAAGCTCTGCCATGG - Intergenic
905720657 1:40197985-40198007 AAAGAAAAACAGCTCTTCCATGG - Intronic
906826423 1:48985352-48985374 AAAATTAAAGAGCTTTGCCAAGG + Intronic
907668637 1:56454897-56454919 AAGGTCAATCAGGTCTGGCATGG + Intergenic
909312383 1:74169183-74169205 AAGGTGAAACAGGTCAGTCATGG - Intronic
909397495 1:75186898-75186920 AAGTTAAAACAGCTCTGCATAGG - Intergenic
909604536 1:77495179-77495201 AAGGTTAAATAACTTTCCCAAGG + Intronic
911237533 1:95427391-95427413 AAAGTTAAACAACTTTCCCAAGG - Intergenic
912838681 1:113019738-113019760 AAGGTTTAACATCTGTGACAAGG - Intergenic
917188669 1:172390328-172390350 GAGGTTAAACAGCTTGCCCAAGG + Intronic
917416504 1:174816029-174816051 AAGTTTAAGAAGCTCTGCAATGG - Intronic
917428672 1:174942549-174942571 AAGGTTAAATAGCTTGCCCAAGG - Intronic
917791331 1:178501063-178501085 GAGGTCAGCCAGCTCTGCCATGG + Intergenic
921045010 1:211469987-211470009 AAAGTTAAGTAGCTGTGCCAAGG + Intergenic
921365717 1:214371743-214371765 AAGGTCAAACAGGTCAGCCCAGG + Intronic
924220309 1:241867699-241867721 GATTTTAAACAGCTGTGCCAAGG - Intronic
1064342266 10:14498136-14498158 AAGGTTCAATTGCTCTGTCATGG - Intergenic
1066196860 10:33108713-33108735 AAAGTTACACAGCTCAGACATGG + Intergenic
1067262572 10:44707098-44707120 AAGGTGAAACAACTCTATCATGG - Intergenic
1067900426 10:50234956-50234978 AAGTTTGAACAACTCTGCCTTGG - Intronic
1071163356 10:82778002-82778024 AAGGTAACCCAGCTCAGCCAAGG + Intronic
1073428748 10:103472240-103472262 AAGGCCAAACAGCCCTGCCTGGG - Intergenic
1075175867 10:120160558-120160580 AAGCAGACACAGCTCTGCCAAGG - Intergenic
1077952146 11:6971344-6971366 AAGGAGCAACAACTCTGCCATGG - Intronic
1078844287 11:15107522-15107544 GAGGTTAAATAGCTCTCCCAAGG - Intergenic
1080101942 11:28469562-28469584 AAGGTTAAATAACTTTCCCAAGG - Intergenic
1081003744 11:37707369-37707391 GAGGTTAATCAACTCTTCCAAGG - Intergenic
1084077725 11:66794449-66794471 AAGGTTAAACAGCTTGTCCAAGG - Intronic
1084601522 11:70148672-70148694 CAGGATAAACAGTTCAGCCAAGG + Intronic
1084998990 11:73011694-73011716 AAGGTTGAAGGGCTCTTCCATGG + Intronic
1086164054 11:83757181-83757203 AAGGCTAAACAACTTTCCCAAGG + Intronic
1086959031 11:92963790-92963812 GAGGTTATACAGCTCATCCAGGG + Intergenic
1086968128 11:93051631-93051653 AAGGTTTGACAGCACAGCCATGG + Intergenic
1088107850 11:106226042-106226064 AAGGTAAAACAGCTTTTCTAGGG - Intergenic
1089250618 11:117157845-117157867 AAGTTTAAACTGGTCTGGCACGG + Intronic
1089977854 11:122747858-122747880 AAGGTTAAATAGCTCACTCAAGG - Intronic
1090269470 11:125376024-125376046 AAGTTAAAACTGCTCTGCGAGGG - Intronic
1091657333 12:2355168-2355190 AAGCTTAATCAGCTCTGACCTGG - Intronic
1094664534 12:32506043-32506065 AAGATTAAGCAGCTTTTCCAAGG + Intronic
1095212393 12:39509574-39509596 AAGGTCAAGGAGCTCTCCCATGG - Intergenic
1095490998 12:42733786-42733808 AAGGTTAAGCAACTGGGCCATGG + Intergenic
1096772694 12:53946110-53946132 AAGGATAAACATCTCTTCCAAGG + Exonic
1097894609 12:64812016-64812038 AAGGTTAAATAACTTTTCCAAGG - Intronic
1098602635 12:72350478-72350500 TAGGTTAAACAGCTTGTCCAAGG + Intronic
1099660687 12:85556297-85556319 AAGGTTGAACTTCTCTGTCAAGG - Intergenic
1100446544 12:94665727-94665749 AAGATTAAAGAGCTCATCCAAGG - Intergenic
1101827163 12:108229398-108229420 AAAGTCAAACAGCTCTGACATGG + Intronic
1102797326 12:115700171-115700193 AAGGTTACCCAGCTCTGTGAAGG - Intergenic
1103338536 12:120208678-120208700 AAGGTTAAACAAAACTGCCCAGG + Intergenic
1105060982 12:133150744-133150766 AATTTTAAACAGCTATGGCAGGG - Intronic
1106346933 13:28888081-28888103 AGGATTAAACTGTTCTGCCAGGG - Intronic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1111454213 13:88458365-88458387 AAGGTTAAATAACTTGGCCAAGG - Intergenic
1113851076 13:113418438-113418460 AAGGAAGGACAGCTCTGCCATGG + Intergenic
1113864916 13:113515016-113515038 CAGGTTAAAAATGTCTGCCAGGG - Intronic
1114487408 14:23071162-23071184 AGGGATAAACAGCACTTCCAGGG - Intronic
1115080082 14:29440062-29440084 AAGTTTAAACAGCTTGCCCAGGG + Intergenic
1115175888 14:30560982-30561004 GAGGTTAAACAGCTTGCCCAGGG - Intronic
1115448265 14:33517034-33517056 AATATTAAACAGTTCTGACATGG + Intronic
1117549013 14:56815817-56815839 AATTTTAAACAGTTCTACCAGGG + Intergenic
1119327305 14:73768286-73768308 AAGGTTAAACAGCTCTGCCAAGG + Intronic
1119711512 14:76825984-76826006 AAGGTTAAGATGCTCTCCCACGG + Intronic
1120038279 14:79723367-79723389 AAGGTTAAATAGCTGGGCCATGG - Intronic
1120589147 14:86354821-86354843 AGGGTTTAACAGCTCTGTCTAGG + Intergenic
1121971211 14:98358187-98358209 AATGACAAACAGCTCTGCCTTGG - Intergenic
1128462815 15:67884193-67884215 AAGGTTAAACAACTTGCCCAAGG - Intergenic
1128723806 15:69973069-69973091 AAGGTTAAAGAGCTTGTCCAAGG - Intergenic
1129671543 15:77610588-77610610 AAGGTTACACAGCTCTGAAGGGG + Intergenic
1129961316 15:79688001-79688023 AAGTTTTAACAGATATGCCAAGG + Intergenic
1130355241 15:83123397-83123419 AAGGTGAAACAGCACTGGCCTGG + Intronic
1132057007 15:98659656-98659678 AGGTGTTAACAGCTCTGCCATGG - Intronic
1132528273 16:428622-428644 AAGGTCAGATAGCTCTCCCAAGG + Intronic
1132990615 16:2790939-2790961 AGGCTTCAACAGCTCTCCCAAGG - Intergenic
1133174063 16:4000427-4000449 TAGCTTAAACAGCAATGCCAGGG - Intronic
1133972260 16:10576894-10576916 AGGGTTCAACAGCTTTGCCCGGG + Intronic
1136984204 16:35084246-35084268 ACGGTTAAGCAGCTCTGCTAGGG - Intergenic
1137669995 16:50273267-50273289 AAGGTCACACAGCTCCTCCAAGG + Intronic
1138858701 16:60728258-60728280 GAGGTTAAACAGCTTACCCAAGG - Intergenic
1140768241 16:78179906-78179928 AGGGTAAAACAGCTGAGCCATGG + Intronic
1141201814 16:81904057-81904079 GAGGTTAAATAGCTCAGCCAGGG + Intronic
1143984063 17:10895933-10895955 AAGGTGACACAGAGCTGCCAGGG + Intergenic
1145038376 17:19557289-19557311 CATGTTAAAAAACTCTGCCAAGG - Intronic
1146633714 17:34488752-34488774 AAGGTTAAGTAACTTTGCCAAGG + Intergenic
1146650772 17:34604918-34604940 AAGGTTAAACAACTTTCTCAAGG + Intronic
1146727381 17:35167282-35167304 AGGGTGAAACAGCTCTCCCCAGG - Intronic
1148531009 17:48391736-48391758 AAGTTTAAATAGCTCTGAAAAGG - Intronic
1148869376 17:50647204-50647226 AAGGTTAAGCACCTTGGCCAAGG - Intronic
1150467648 17:65407736-65407758 AAAGTTAATGAGCTCTGCCCTGG + Intergenic
1151506149 17:74528747-74528769 GAGGTTAAGCAACTCTGCCAGGG - Intronic
1153483934 18:5576075-5576097 AAAGTCAAACAGCTCTGTTAAGG + Intronic
1162042124 19:7977343-7977365 GTAGTGAAACAGCTCTGCCAAGG - Intronic
1162955357 19:14094615-14094637 TGGGTTAAACAGCTCTTCCTAGG + Intronic
1164212602 19:23112867-23112889 TAGGTTAAAGAGCATTGCCAGGG + Intronic
1164218934 19:23175757-23175779 TAGGTTAAAGAGCATTGCCAAGG + Intergenic
1164708092 19:30335235-30335257 GAGGTTAAATGGCTCTCCCAAGG - Intronic
1165031512 19:33001131-33001153 AAGGTAAAACAGCTCATTCATGG + Intronic
1167808065 19:51803533-51803555 ATGGTCAAACTGCTCTGCCTTGG - Intronic
1168437424 19:56331493-56331515 AAGGTGAAACATCTCTACCAGGG - Intronic
925481845 2:4284110-4284132 AAATTTCTACAGCTCTGCCAAGG + Intergenic
925563391 2:5222971-5222993 AAAGTTAAGCAGCTTTCCCAGGG + Intergenic
926048136 2:9725113-9725135 GAAGTTAAACAGCTTGGCCAAGG - Intergenic
926797546 2:16631047-16631069 AAGGTCACACAGCCCAGCCAAGG - Intronic
927588157 2:24329004-24329026 AAGGTTAAATAACTTTTCCATGG - Intronic
928038256 2:27847188-27847210 AAGGTTAAAAAGGTTTTCCAAGG - Intronic
928256505 2:29727480-29727502 AAGGTTAAGCAGCTTACCCAAGG - Intronic
930030930 2:47057556-47057578 CAGCTTAATCAGCTGTGCCAGGG + Intronic
930240621 2:48932318-48932340 GAGGTTAAGCAACTCTGCCAAGG - Intergenic
931077348 2:58730842-58730864 AATGTTAAACACCTCTGCATGGG - Intergenic
931979597 2:67680232-67680254 TAGGTTTCACAGCTCTGCCATGG - Intergenic
932220698 2:69996846-69996868 AGGGTTAAGCACCTCTGTCAAGG + Intergenic
932543533 2:72682781-72682803 AAGGTTAAGAAGCTATTCCATGG + Intronic
933998114 2:87684869-87684891 GAGGTTAAACAACTTTCCCACGG + Intergenic
934792200 2:97070781-97070803 GAGGTTAAACAACTTTCCCACGG - Intergenic
934814417 2:97312928-97312950 GAGGTTAAACAACTTTCCCACGG + Intergenic
934823276 2:97395555-97395577 GAGGTTAAACAACTTTCCCACGG - Intergenic
935104115 2:100023754-100023776 AATGTTAAAGTGCTCTGCCAAGG + Intronic
936083146 2:109448893-109448915 GAGCTAAAACAGCTTTGCCAAGG - Intronic
936295738 2:111266004-111266026 GAGGTTAAACAACTTTCCCACGG - Intergenic
936444146 2:112583157-112583179 AAGGTTAGACAGATCTTCTAAGG + Intergenic
937085912 2:119171680-119171702 AAGGTTAAAACGCTGTGCCCTGG + Intergenic
938878542 2:135559781-135559803 AAACATAAAGAGCTCTGCCAGGG - Intronic
942920640 2:181369558-181369580 AAGGTCATACAGCTCTTCCCAGG + Intergenic
945863055 2:215145765-215145787 GAGGTTAAACATTTCTACCACGG - Intergenic
948284107 2:236770627-236770649 AAGCATGCACAGCTCTGCCAGGG + Intergenic
948341183 2:237253552-237253574 AATGTGACACAGCCCTGCCAAGG - Intergenic
1169187920 20:3634420-3634442 AAGGAAAAAAAGCTCTTCCAGGG - Intronic
1170793055 20:19523691-19523713 AAGGCAAAACAGCTTTCCCATGG - Intronic
1172416881 20:34776635-34776657 AAGGTTAAATAGCTCGTTCATGG - Intronic
1174017945 20:47503727-47503749 TAGGATAAAGAACTCTGCCAGGG + Intronic
1174066863 20:47871925-47871947 AAACTTAAACAGCACTGACAAGG + Intergenic
1175151041 20:56934645-56934667 AAGGTTGATCAGCTATGTCAGGG - Intergenic
1175994521 20:62806057-62806079 AAAGTGAAACAGCCCCGCCAGGG - Intronic
1182150159 22:28022038-28022060 AAGGTTAAACATCTCCTCTAAGG + Intronic
1183296858 22:37034896-37034918 AAGGTTTTACAGCCCAGCCAAGG - Intergenic
1183489709 22:38109828-38109850 GAGGTTAAACAGCTCATTCAAGG - Intronic
953328390 3:42031870-42031892 AAGATTAAACAGCTGATCCAAGG + Intronic
955426055 3:58791096-58791118 AACTTTACACATCTCTGCCAGGG - Intronic
955503494 3:59607887-59607909 GAGGCTAAACGACTCTGCCAAGG - Intergenic
957449639 3:80362405-80362427 ACTGTTTAACTGCTCTGCCACGG + Intergenic
957861107 3:85951550-85951572 TATGTTAAACAGCTCTGGGACGG + Intronic
958804758 3:98796459-98796481 AAGCTTAAACACCTTTGCCCTGG - Exonic
958849761 3:99310408-99310430 GAGGTGAAAGAGCTCTACCATGG + Intergenic
961380515 3:126493628-126493650 AAGGTGAAAAAGCTCTGAGATGG + Intronic
962048682 3:131789476-131789498 AAGGTTAAATAACTTGGCCATGG - Intronic
962317596 3:134368493-134368515 AAGGTTAAACAGCTGGAGCAGGG - Intronic
967225234 3:187284749-187284771 AAGGTTAAGCAACTCACCCAAGG - Intronic
969224383 4:5785297-5785319 ATGGCTTAACAGCACTGCCAGGG - Intronic
969289101 4:6227323-6227345 AAGGTTAACCAGCTTACCCAAGG - Intergenic
969763700 4:9211457-9211479 AACTTTACACAACTCTGCCAAGG + Exonic
969764306 4:9216205-9216227 AACTTTACACACCTCTGCCAAGG + Exonic
969765520 4:9225696-9225718 AACTTTACACACCTCTGCCAAGG + Exonic
969766745 4:9235185-9235207 AACTTTACACACCTCTGCCAAGG + Exonic
969767354 4:9239930-9239952 AACTTTACACACCTCTGCCAAGG + Intronic
969767960 4:9244679-9244701 AACTTTACACACCTCTGCCAAGG + Exonic
969768563 4:9249430-9249452 AACTTTACACACCTCTGCCAAGG + Exonic
969769170 4:9254178-9254200 AACTTTACACACCTCTGCCAAGG + Exonic
969769784 4:9258924-9258946 AACTTTACACACCTCTGCCAAGG + Exonic
969771006 4:9268419-9268441 AACTTTACACACCTCTGCCAAGG + Exonic
969771983 4:9325965-9325987 AACTTTACACACCTCTGCCAAGG + Exonic
969772599 4:9330711-9330733 AACTTTACACACCTCTGCCAAGG + Exonic
969773216 4:9335458-9335480 AACTTTACACACCTCTGCCAAGG + Exonic
969773831 4:9340203-9340225 AACTTTACACACCTCTGCCAAGG + Exonic
969774446 4:9344948-9344970 AACTTTACACACCTCTGCCAAGG + Exonic
969775061 4:9349693-9349715 AACTTTACACACCTCTGCCAAGG + Exonic
969775676 4:9354438-9354460 AACTTTACACACCTCTGCCAAGG + Exonic
969776291 4:9359183-9359205 AACTTTACACACCTCTGCCAAGG + Intronic
969776905 4:9363929-9363951 AACTTTACACACCTCTGCCAAGG + Exonic
969777520 4:9368674-9368696 AACTTTACACACCTCTGCCAAGG + Intergenic
970212327 4:13722494-13722516 AAGGCTGCTCAGCTCTGCCAAGG + Intergenic
970809625 4:20077268-20077290 AAGGTTAAACAACTTATCCAAGG + Intergenic
971452974 4:26817461-26817483 AAAGTTGAACAGCTCCTCCAAGG - Intergenic
972151229 4:36093568-36093590 AAGGTTAAGCAGATTTCCCAAGG + Intronic
972823140 4:42725248-42725270 AAGGTTAAACAACTTTCCCAAGG + Intergenic
975796838 4:78015015-78015037 AAGGGTAAACAACTCTTTCATGG - Intergenic
975949006 4:79745293-79745315 ATGCTTAAACAGCTCTCGCAAGG + Intergenic
980729360 4:136806418-136806440 AAGGTGAAAGAGATCTGCTAAGG - Intergenic
980863406 4:138525961-138525983 GAGGTGAAAGATCTCTGCCAGGG + Intergenic
981758589 4:148168648-148168670 AAGGCTAAAAACCTCTCCCAAGG + Intronic
986471377 5:8080389-8080411 AATGTTAAACCTCTCTGCCCAGG - Intergenic
987066463 5:14294696-14294718 GAGGTTAAACAGCCTTCCCAAGG - Intronic
990401758 5:55445116-55445138 AAGTTTAATCAGCTCTGAGAAGG - Intronic
991565079 5:67996859-67996881 AAGGTTCCGCATCTCTGCCATGG + Intergenic
991661209 5:68952450-68952472 GAGGTTAAAAAGATCAGCCATGG - Intergenic
996414185 5:123191881-123191903 CAGGTTAAACATCTGTGGCAAGG - Exonic
997416024 5:133729347-133729369 AAGTTTAAGTAGCTCTCCCAAGG - Intergenic
998071364 5:139200440-139200462 AACCTTGAAAAGCTCTGCCATGG + Intronic
998146534 5:139732187-139732209 AAGGTTAAATAACTCTTCCAAGG - Intergenic
998792533 5:145780446-145780468 AAAATTAAATAGCTCAGCCAAGG + Intronic
1001809008 5:174612824-174612846 AAGGTTACTCATCTCTGGCAAGG + Intergenic
1004510762 6:16282533-16282555 AAGGTTAAGCAACTCTCCTAAGG - Intronic
1006037049 6:31222098-31222120 AACATTAAACACTTCTGCCATGG - Intergenic
1006928850 6:37675249-37675271 GAGGTTAAACAACTTTCCCAAGG - Intronic
1007605065 6:43112022-43112044 AAGGATAAACAGCTTGTCCAAGG + Intronic
1007916994 6:45570518-45570540 GAGGTTAAGCAGCTTAGCCAAGG + Intronic
1008122108 6:47630735-47630757 AAGGTTAAGCAACTTGGCCAAGG + Intergenic
1009981447 6:70730355-70730377 AAGGTTAAACAGATATGCAGTGG - Intronic
1010007317 6:71010269-71010291 AAGGTGATCCAGCTCAGCCAAGG + Intergenic
1011319205 6:86071436-86071458 AAGCCTAAGCAGTTCTGCCAGGG + Intergenic
1012718950 6:102716467-102716489 AAGGAGAAACAGCACTGACAAGG + Intergenic
1013134760 6:107271417-107271439 AAGGCTGATCAGCTCTGCTAGGG - Intronic
1015041106 6:128719787-128719809 AAGATTGGACACCTCTGCCAGGG + Intergenic
1018002352 6:159590915-159590937 AAGGTTAATCAACTTTCCCAAGG + Intergenic
1019016120 6:168880727-168880749 AAGGTCACCCAGCTCTGCCAAGG - Intergenic
1020076672 7:5263121-5263143 AAGGTTCAACAGCCCTGCCTCGG - Intergenic
1023361290 7:39418397-39418419 AAAGTTAAACAGGTCAGGCACGG + Intronic
1024301271 7:47889488-47889510 AAGGTCATACAGCACTGCCCAGG - Intronic
1025202420 7:56970473-56970495 AAGGTTCAACAGCCCTGCCTCGG + Intergenic
1025669528 7:63606454-63606476 AAGGTTCAACAGCCCTGCCTCGG - Intergenic
1025725851 7:64058875-64058897 AAGGGTAAAGAGGTCTTCCATGG - Intronic
1026246343 7:68623311-68623333 CAGGATAAACAGCAGTGCCAAGG - Intergenic
1027462130 7:78467278-78467300 AAGGATAAACAGCTATGCCTTGG + Intronic
1028210763 7:88071452-88071474 AAGATTAAGCAGCTTGGCCAAGG + Intronic
1030944901 7:115706129-115706151 GAGGTTAAATAACTCTCCCAAGG - Intergenic
1032957546 7:136988554-136988576 AAGGTTACACAGCTCTGCACTGG + Intronic
1033134991 7:138776783-138776805 GAGGTTAAATAGCTTTCCCAAGG - Intronic
1033853663 7:145529427-145529449 AAGGTTAAACAGGTCTTAGATGG - Intergenic
1034514784 7:151567297-151567319 AAGGTTAAGTAGCTTTGCCAAGG - Intronic
1038670351 8:29578063-29578085 AAGTTCAAACAGCTCTTTCAAGG - Intergenic
1044124680 8:88443167-88443189 AAGGATAATTAGCTCTGCCATGG + Intergenic
1045444639 8:102248078-102248100 AAAGTAAAACAGCTTTGTCAAGG + Intergenic
1046706000 8:117452406-117452428 AAGGCTAAACAGCTTAGCAAAGG + Intergenic
1050680730 9:8108272-8108294 AAGGTTAAATGACTCTTCCAAGG - Intergenic
1051196453 9:14566960-14566982 AAAATTAACCAGCCCTGCCAGGG + Intergenic
1052431289 9:28370007-28370029 AATATTAAACAGCTCTCACATGG + Intronic
1052791834 9:32882389-32882411 AATGTTAAGAAGTTCTGCCATGG + Intergenic
1053050371 9:34956987-34957009 GAGGTTAAACAACTCGCCCAAGG - Intergenic
1053310579 9:37016100-37016122 AAGGTTAAACAGTTTTCCTAGGG + Intronic
1055255290 9:74362672-74362694 AAGATAAAACTGCTCTTCCAAGG + Intergenic
1055545205 9:77364091-77364113 AGGGTAAAAAAGCTCTGCCTTGG - Intronic
1055836442 9:80448550-80448572 ATGATTAAACTTCTCTGCCATGG + Intergenic
1057008303 9:91580459-91580481 AAGGTTAAACTCCTCTGAAATGG + Intronic
1059522836 9:114959879-114959901 CAGGTTAAACAGCTTGACCAAGG - Intergenic
1059674690 9:116526740-116526762 AAGCTTAAACAAATCTGCTAGGG - Intronic
1059923843 9:119186640-119186662 AAGGTGATACAGATCAGCCAAGG - Intronic
1060712657 9:125884782-125884804 AAGGATAAACATCTCTTACAAGG - Intronic
1062657800 9:137613222-137613244 AGGGTGAAACAGCTGTGCCAGGG - Intronic
1189273262 X:39766850-39766872 ATGGTTAAAAACCCCTGCCAAGG + Intergenic
1189951414 X:46235157-46235179 AAGGGTAAACAGCTTTGCCAAGG - Intergenic
1189969619 X:46404998-46405020 GAGGTTAACCAGCTGTGACAGGG - Intergenic
1190281611 X:48934739-48934761 ACGGTTGTACATCTCTGCCATGG + Exonic
1192175000 X:68879947-68879969 AAGGCTTAATAGCTCAGCCAGGG + Intergenic
1192570755 X:72202245-72202267 CAGGTTAAAAATCCCTGCCATGG + Intronic
1193871827 X:86807426-86807448 AAGGTTAAGCAACTTTCCCAGGG + Intronic
1195527224 X:105905256-105905278 AAGGTTACACAGAGCTGCAAAGG - Exonic
1196610563 X:117709792-117709814 AAGGTTAAACAACTTGCCCAAGG + Intergenic
1198569452 X:137939593-137939615 ATGGTTAGTCGGCTCTGCCAAGG + Intergenic
1199550409 X:149055893-149055915 AAGGTCACACACCTCTGCTAAGG + Intergenic
1201970365 Y:19786423-19786445 AAGGTGAAAAATCTCTGCAAGGG + Intergenic