ID: 1119331816

View in Genome Browser
Species Human (GRCh38)
Location 14:73800571-73800593
Sequence ATGGAAAACCAGAACCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119331816_1119331819 3 Left 1119331816 14:73800571-73800593 CCTTCCTGGTTCTGGTTTTCCAT No data
Right 1119331819 14:73800597-73800619 CTCCCCTGTCCCCAGCTGTCTGG No data
1119331816_1119331822 6 Left 1119331816 14:73800571-73800593 CCTTCCTGGTTCTGGTTTTCCAT No data
Right 1119331822 14:73800600-73800622 CCCTGTCCCCAGCTGTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119331816 Original CRISPR ATGGAAAACCAGAACCAGGA AGG (reversed) Intergenic
No off target data available for this crispr