ID: 1119332070

View in Genome Browser
Species Human (GRCh38)
Location 14:73802459-73802481
Sequence TGCAAACCCTCGTTGAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119332070_1119332082 11 Left 1119332070 14:73802459-73802481 CCTCCTTTCAACGAGGGTTTGCA No data
Right 1119332082 14:73802493-73802515 GTGGGGTGCTGAGGATGCCAGGG No data
1119332070_1119332078 2 Left 1119332070 14:73802459-73802481 CCTCCTTTCAACGAGGGTTTGCA No data
Right 1119332078 14:73802484-73802506 GCCAGGCCTGTGGGGTGCTGAGG No data
1119332070_1119332076 -7 Left 1119332070 14:73802459-73802481 CCTCCTTTCAACGAGGGTTTGCA No data
Right 1119332076 14:73802475-73802497 GTTTGCAGGGCCAGGCCTGTGGG No data
1119332070_1119332083 15 Left 1119332070 14:73802459-73802481 CCTCCTTTCAACGAGGGTTTGCA No data
Right 1119332083 14:73802497-73802519 GGTGCTGAGGATGCCAGGGAAGG No data
1119332070_1119332075 -8 Left 1119332070 14:73802459-73802481 CCTCCTTTCAACGAGGGTTTGCA No data
Right 1119332075 14:73802474-73802496 GGTTTGCAGGGCCAGGCCTGTGG No data
1119332070_1119332081 10 Left 1119332070 14:73802459-73802481 CCTCCTTTCAACGAGGGTTTGCA No data
Right 1119332081 14:73802492-73802514 TGTGGGGTGCTGAGGATGCCAGG No data
1119332070_1119332077 -6 Left 1119332070 14:73802459-73802481 CCTCCTTTCAACGAGGGTTTGCA No data
Right 1119332077 14:73802476-73802498 TTTGCAGGGCCAGGCCTGTGGGG No data
1119332070_1119332085 20 Left 1119332070 14:73802459-73802481 CCTCCTTTCAACGAGGGTTTGCA No data
Right 1119332085 14:73802502-73802524 TGAGGATGCCAGGGAAGGTAGGG No data
1119332070_1119332084 19 Left 1119332070 14:73802459-73802481 CCTCCTTTCAACGAGGGTTTGCA No data
Right 1119332084 14:73802501-73802523 CTGAGGATGCCAGGGAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119332070 Original CRISPR TGCAAACCCTCGTTGAAAGG AGG (reversed) Intergenic
No off target data available for this crispr