ID: 1119332079

View in Genome Browser
Species Human (GRCh38)
Location 14:73802485-73802507
Sequence TCCTCAGCACCCCACAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119332079_1119332090 24 Left 1119332079 14:73802485-73802507 CCAGGCCTGTGGGGTGCTGAGGA No data
Right 1119332090 14:73802532-73802554 CCTGTTTCCGGAACTTCCTGAGG No data
1119332079_1119332084 -7 Left 1119332079 14:73802485-73802507 CCAGGCCTGTGGGGTGCTGAGGA No data
Right 1119332084 14:73802501-73802523 CTGAGGATGCCAGGGAAGGTAGG No data
1119332079_1119332087 12 Left 1119332079 14:73802485-73802507 CCAGGCCTGTGGGGTGCTGAGGA No data
Right 1119332087 14:73802520-73802542 TAGGGTATGAGCCCTGTTTCCGG No data
1119332079_1119332085 -6 Left 1119332079 14:73802485-73802507 CCAGGCCTGTGGGGTGCTGAGGA No data
Right 1119332085 14:73802502-73802524 TGAGGATGCCAGGGAAGGTAGGG No data
1119332079_1119332091 29 Left 1119332079 14:73802485-73802507 CCAGGCCTGTGGGGTGCTGAGGA No data
Right 1119332091 14:73802537-73802559 TTCCGGAACTTCCTGAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119332079 Original CRISPR TCCTCAGCACCCCACAGGCC TGG (reversed) Intergenic
No off target data available for this crispr