ID: 1119332080

View in Genome Browser
Species Human (GRCh38)
Location 14:73802490-73802512
Sequence TGGCATCCTCAGCACCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119332080_1119332090 19 Left 1119332080 14:73802490-73802512 CCTGTGGGGTGCTGAGGATGCCA No data
Right 1119332090 14:73802532-73802554 CCTGTTTCCGGAACTTCCTGAGG No data
1119332080_1119332087 7 Left 1119332080 14:73802490-73802512 CCTGTGGGGTGCTGAGGATGCCA No data
Right 1119332087 14:73802520-73802542 TAGGGTATGAGCCCTGTTTCCGG No data
1119332080_1119332093 28 Left 1119332080 14:73802490-73802512 CCTGTGGGGTGCTGAGGATGCCA No data
Right 1119332093 14:73802541-73802563 GGAACTTCCTGAGGAGTGGCTGG No data
1119332080_1119332091 24 Left 1119332080 14:73802490-73802512 CCTGTGGGGTGCTGAGGATGCCA No data
Right 1119332091 14:73802537-73802559 TTCCGGAACTTCCTGAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119332080 Original CRISPR TGGCATCCTCAGCACCCCAC AGG (reversed) Intergenic
No off target data available for this crispr