ID: 1119332084

View in Genome Browser
Species Human (GRCh38)
Location 14:73802501-73802523
Sequence CTGAGGATGCCAGGGAAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119332079_1119332084 -7 Left 1119332079 14:73802485-73802507 CCAGGCCTGTGGGGTGCTGAGGA No data
Right 1119332084 14:73802501-73802523 CTGAGGATGCCAGGGAAGGTAGG No data
1119332072_1119332084 16 Left 1119332072 14:73802462-73802484 CCTTTCAACGAGGGTTTGCAGGG No data
Right 1119332084 14:73802501-73802523 CTGAGGATGCCAGGGAAGGTAGG No data
1119332070_1119332084 19 Left 1119332070 14:73802459-73802481 CCTCCTTTCAACGAGGGTTTGCA No data
Right 1119332084 14:73802501-73802523 CTGAGGATGCCAGGGAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119332084 Original CRISPR CTGAGGATGCCAGGGAAGGT AGG Intergenic
No off target data available for this crispr