ID: 1119332087

View in Genome Browser
Species Human (GRCh38)
Location 14:73802520-73802542
Sequence TAGGGTATGAGCCCTGTTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119332079_1119332087 12 Left 1119332079 14:73802485-73802507 CCAGGCCTGTGGGGTGCTGAGGA No data
Right 1119332087 14:73802520-73802542 TAGGGTATGAGCCCTGTTTCCGG No data
1119332080_1119332087 7 Left 1119332080 14:73802490-73802512 CCTGTGGGGTGCTGAGGATGCCA No data
Right 1119332087 14:73802520-73802542 TAGGGTATGAGCCCTGTTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119332087 Original CRISPR TAGGGTATGAGCCCTGTTTC CGG Intergenic
No off target data available for this crispr