ID: 1119332090

View in Genome Browser
Species Human (GRCh38)
Location 14:73802532-73802554
Sequence CCTGTTTCCGGAACTTCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119332080_1119332090 19 Left 1119332080 14:73802490-73802512 CCTGTGGGGTGCTGAGGATGCCA No data
Right 1119332090 14:73802532-73802554 CCTGTTTCCGGAACTTCCTGAGG No data
1119332086_1119332090 -1 Left 1119332086 14:73802510-73802532 CCAGGGAAGGTAGGGTATGAGCC No data
Right 1119332090 14:73802532-73802554 CCTGTTTCCGGAACTTCCTGAGG No data
1119332079_1119332090 24 Left 1119332079 14:73802485-73802507 CCAGGCCTGTGGGGTGCTGAGGA No data
Right 1119332090 14:73802532-73802554 CCTGTTTCCGGAACTTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119332090 Original CRISPR CCTGTTTCCGGAACTTCCTG AGG Intergenic
No off target data available for this crispr