ID: 1119333355

View in Genome Browser
Species Human (GRCh38)
Location 14:73811974-73811996
Sequence CACGTGAATCCAGGAGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142957
Summary {0: 2, 1: 457, 2: 9102, 3: 41244, 4: 92152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119333350_1119333355 9 Left 1119333350 14:73811942-73811964 CCTAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 1119333355 14:73811974-73811996 CACGTGAATCCAGGAGGCGGAGG 0: 2
1: 457
2: 9102
3: 41244
4: 92152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119333355 Original CRISPR CACGTGAATCCAGGAGGCGG AGG Intergenic
Too many off-targets to display for this crispr