ID: 1119333355 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:73811974-73811996 |
| Sequence | CACGTGAATCCAGGAGGCGG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 142957 | |||
| Summary | {0: 2, 1: 457, 2: 9102, 3: 41244, 4: 92152} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1119333350_1119333355 | 9 | Left | 1119333350 | 14:73811942-73811964 | CCTAGCTACTCGGGAGGCTGAGG | 0: 99957 1: 284367 2: 226920 3: 125442 4: 164576 |
||
| Right | 1119333355 | 14:73811974-73811996 | CACGTGAATCCAGGAGGCGGAGG | 0: 2 1: 457 2: 9102 3: 41244 4: 92152 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1119333355 | Original CRISPR | CACGTGAATCCAGGAGGCGG AGG | Intergenic | ||
| Too many off-targets to display for this crispr | |||||