ID: 1119343272

View in Genome Browser
Species Human (GRCh38)
Location 14:73899599-73899621
Sequence CTCCCTACGCTGCTTCTCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 103}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119343272_1119343278 10 Left 1119343272 14:73899599-73899621 CCAATGAGAAGCAGCGTAGGGAG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1119343278 14:73899632-73899654 AATTTAGAATCTGGGAGCCCTGG 0: 1
1: 0
2: 1
3: 11
4: 216
1119343272_1119343279 11 Left 1119343272 14:73899599-73899621 CCAATGAGAAGCAGCGTAGGGAG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1119343279 14:73899633-73899655 ATTTAGAATCTGGGAGCCCTGGG 0: 1
1: 0
2: 0
3: 16
4: 202
1119343272_1119343276 1 Left 1119343272 14:73899599-73899621 CCAATGAGAAGCAGCGTAGGGAG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1119343276 14:73899623-73899645 GGAGCTTGCAATTTAGAATCTGG 0: 1
1: 0
2: 0
3: 15
4: 170
1119343272_1119343280 18 Left 1119343272 14:73899599-73899621 CCAATGAGAAGCAGCGTAGGGAG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1119343280 14:73899640-73899662 ATCTGGGAGCCCTGGGATCCAGG 0: 1
1: 0
2: 1
3: 33
4: 352
1119343272_1119343281 23 Left 1119343272 14:73899599-73899621 CCAATGAGAAGCAGCGTAGGGAG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1119343281 14:73899645-73899667 GGAGCCCTGGGATCCAGGCCTGG 0: 1
1: 0
2: 12
3: 86
4: 612
1119343272_1119343277 2 Left 1119343272 14:73899599-73899621 CCAATGAGAAGCAGCGTAGGGAG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1119343277 14:73899624-73899646 GAGCTTGCAATTTAGAATCTGGG 0: 1
1: 0
2: 1
3: 11
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119343272 Original CRISPR CTCCCTACGCTGCTTCTCAT TGG (reversed) Intronic
901255448 1:7822016-7822038 TTCCCTACTCTACTACTCATGGG - Intronic
902610970 1:17596940-17596962 CTCCCTGCCCTGCTGCTCTTTGG + Intronic
906046194 1:42832783-42832805 CTCCCCACGCTCCTCCTAATGGG - Intronic
906940853 1:50253872-50253894 CTCCCCAAGCTGCTTCTCTCTGG - Intergenic
907535828 1:55155718-55155740 CTCCCAGCGCTTCCTCTCATTGG - Intronic
907906349 1:58785672-58785694 CTCCCCTCGATGCTTCTCACAGG - Intergenic
908693646 1:66811538-66811560 CTCTCTAAGCTCCCTCTCATAGG - Intergenic
909698384 1:78492066-78492088 CTCACCACTCTGCTTTTCATGGG + Intronic
917644307 1:177014873-177014895 CTCCTTACCCTGCTTCTAAGGGG - Exonic
920398441 1:205662677-205662699 CTGCATACACGGCTTCTCATGGG - Intronic
1074990542 10:118702240-118702262 CTCCCTTCGCTGATTCTTTTCGG + Intronic
1081538088 11:44009904-44009926 CTTCTTACTCTGCTTCTCCTGGG + Intergenic
1081780784 11:45710511-45710533 CTCACTTGTCTGCTTCTCATAGG - Intergenic
1083775826 11:64893930-64893952 CTCCCTGCCCTGCTTCCCAGTGG - Intergenic
1084287793 11:68142991-68143013 GTCCCCAGGCTGCATCTCATTGG + Intergenic
1085885679 11:80518893-80518915 CTCCCTTCCTTGCTTCTTATTGG + Intergenic
1089456004 11:118626167-118626189 CTCCCTCCCCTGCCTCTGATTGG + Intronic
1090207063 11:124891291-124891313 CTCCTTACCCTGCTTCTTTTTGG + Exonic
1090929022 11:131278786-131278808 ATCCCGCAGCTGCTTCTCATTGG - Intergenic
1091080149 11:132658638-132658660 CTCCCTACCCAACTTCTCAGCGG - Intronic
1104046906 12:125169775-125169797 CCCCCTACGTGTCTTCTCATTGG + Intergenic
1104303102 12:127583835-127583857 CTGCTTTAGCTGCTTCTCATAGG + Intergenic
1104829721 12:131741880-131741902 TTCCCTCCGCTGCTTTTCCTGGG + Intronic
1106724374 13:32469464-32469486 CTCCCTGCGCTGCATCCCACAGG - Intronic
1110151337 13:72258515-72258537 CTCCCGTCCATGCTTCTCATTGG + Intergenic
1112192508 13:97191782-97191804 CTTCCTAAGCTTCTTCTCATTGG - Intergenic
1116702683 14:48260629-48260651 CTCCCTTCGCTGACTCTCTTCGG - Intergenic
1118824766 14:69370043-69370065 CTCCCTAGACTGCTTCTGACTGG - Intergenic
1119343272 14:73899599-73899621 CTCCCTACGCTGCTTCTCATTGG - Intronic
1120080908 14:80215207-80215229 TGCCCTAGGCTGCTTCTCTTTGG - Intronic
1121173008 14:91870187-91870209 CCTCCGACGCTGCCTCTCATTGG - Exonic
1130354039 15:83113879-83113901 CTCCCTATGCTGTTGCTGATGGG - Intronic
1134097007 16:11424689-11424711 CTCCCTTCGCTGCTGCACCTGGG + Intronic
1139687498 16:68615844-68615866 GTCCCTTAGCTGATTCTCATGGG - Intergenic
1140126823 16:72124821-72124843 CTCCCTGAGCTGCTCCTCTTTGG + Exonic
1141317027 16:82972087-82972109 CACCCTACACTGCTTCACTTGGG - Intronic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1144738058 17:17565935-17565957 CTCCCGCAGCTGCTTCTCCTTGG + Intronic
1149008123 17:51826779-51826801 CTCCCTACTCAGGGTCTCATTGG + Intronic
1149915134 17:60601146-60601168 CTCCCTTCCCTGCTTCACTTTGG + Intronic
1151894735 17:76972330-76972352 CTCCCAAGGCTGCCTCTCTTGGG + Intergenic
1152466895 17:80471607-80471629 CTCCCCGGGCTGCTTCTCAGGGG + Intronic
1153571151 18:6474998-6475020 TTCCCTTCGCAGTTTCTCATTGG + Intergenic
1156459692 18:37314782-37314804 CTGCCTACCTTGCTTCTCCTGGG + Intronic
1157328670 18:46687441-46687463 GTCCATAGGCTGCTTCTCCTTGG + Intronic
1162772346 19:12956865-12956887 CTCCCGACGCTTCTGCTCTTCGG + Exonic
1167381909 19:49143099-49143121 CCCACGACCCTGCTTCTCATTGG + Intronic
1167508105 19:49881777-49881799 ATCCCAGAGCTGCTTCTCATTGG + Intronic
927097599 2:19759406-19759428 GTCCCTAACCTGCTTCTTATTGG - Intergenic
935675188 2:105589204-105589226 CTTCCTTGGCTGCTTCTCTTGGG + Intergenic
936231813 2:110708959-110708981 CTGCCTTTGCTGCATCTCATAGG + Intergenic
936255082 2:110904367-110904389 CACCCTTCCCTGCTTCTCCTTGG - Intronic
936980073 2:118255860-118255882 CTCCTTAGGCTGGTTCTCCTGGG + Intergenic
939985531 2:148826261-148826283 CCCCCTACCCTGATTCTGATGGG + Intergenic
940385331 2:153064742-153064764 CCCCCTACTCTGTCTCTCATTGG + Intergenic
948367828 2:237469928-237469950 CTCCCTTCCCTGCTGCTCAAGGG - Intergenic
1176218032 20:63957402-63957424 CTCCCTACGCTGGCCCACATAGG - Exonic
1178000268 21:28154276-28154298 CTCCCTAAGCTGCTTTTCCCTGG + Intergenic
1178891608 21:36524996-36525018 CTCCATCACCTGCTTCTCATGGG + Intronic
1179381974 21:40908298-40908320 CTCCCTCCCCTGCCTCTCACTGG + Intergenic
1179917620 21:44487967-44487989 CTCCCAACTCTGTTTCTGATGGG + Intergenic
1181286929 22:21759106-21759128 ATCCCTGCACTGCTTCTCTTTGG + Exonic
1181734834 22:24873518-24873540 CTCCCTCAGCTGTTTCTCATAGG - Intronic
1182442263 22:30371464-30371486 TTACCCACCCTGCTTCTCATGGG - Intronic
1184355852 22:43979190-43979212 CTCCCCACCCTGCTTCTCTCTGG + Intronic
1184358097 22:43996007-43996029 CTCCCTGCTCCGCCTCTCATCGG + Intronic
1184898796 22:47430809-47430831 CTTCCTCCAGTGCTTCTCATTGG - Intergenic
949740853 3:7231933-7231955 CTCCCTCAGCAGCTTCCCATGGG - Intronic
950227275 3:11246207-11246229 CTCCCTAGGCTGCTACTCTGAGG + Intronic
952506130 3:34008259-34008281 CTCACTGGGCTGCTTCACATGGG + Intergenic
954794974 3:53156824-53156846 CCCCCTACACTGTTTCCCATGGG + Intronic
956939063 3:74136132-74136154 CTCCCTAAGCTGCTTCTGAATGG - Intergenic
964766658 3:160186073-160186095 CTCCCTACCCAGGTTCTCAGAGG - Intergenic
965054937 3:163699611-163699633 CTCCTCACTCTCCTTCTCATAGG - Intergenic
965823873 3:172711107-172711129 CTCCCGACGCAGCCTCTGATTGG - Exonic
967420344 3:189265513-189265535 CTCCCATCTCTCCTTCTCATAGG + Intronic
972328816 4:38044306-38044328 CTCCCTTCTCTGCTTCTTAAAGG - Intronic
974810353 4:66937847-66937869 TTCCATACGTTGCTTCTCTTGGG - Intergenic
976848419 4:89516476-89516498 GTCACGACTCTGCTTCTCATGGG + Intergenic
980718683 4:136663069-136663091 TTCCCTTTGCTGTTTCTCATAGG - Intergenic
989210470 5:38854274-38854296 CTTATCACGCTGCTTCTCATGGG + Intronic
992662589 5:78976154-78976176 CTCCCCACCCTCCTTCCCATAGG - Intronic
994145751 5:96393305-96393327 CCCCCTACGCTGCTGCTGCTGGG + Exonic
997614717 5:135238569-135238591 CTCCCTGCGCTGCCTCTCAGTGG - Intronic
997620539 5:135288886-135288908 CTGCCTTCGCTGCATCTCATAGG + Intronic
997819755 5:137054519-137054541 GTCCCTTAGCTGCTGCTCATGGG + Intronic
999617137 5:153436525-153436547 CTGCATATGCTGCTTCTCAAAGG + Intergenic
999772407 5:154785579-154785601 CTACCTACTCTGCTCCTCACAGG - Intronic
1003006632 6:2388904-2388926 ATCCCTACACTGCTGCTAATAGG + Intergenic
1004406432 6:15337744-15337766 CTCCCAACTCTGTTTCTGATAGG + Intronic
1005477849 6:26225776-26225798 CTCCCTACGCTGTTCTCCATTGG + Intergenic
1009858309 6:69292640-69292662 CTCCCTACAGTGGATCTCATTGG - Intronic
1012915053 6:105160960-105160982 CTCCCCAGCCTGCTTCTCATGGG + Intronic
1012968758 6:105704300-105704322 CTGGCGACGCTGCTTCTCCTGGG + Intergenic
1014454388 6:121620510-121620532 CTCCCTTCGCTGACTCTCTTCGG - Intergenic
1018576381 6:165264308-165264330 CTTCCTTTCCTGCTTCTCATGGG + Intergenic
1022591040 7:31663129-31663151 CTTCATACTCTGATTCTCATGGG + Intergenic
1024419561 7:49147812-49147834 TTCCCTACGATGCTTGCCATGGG - Intergenic
1025284781 7:57652515-57652537 CTCCCTACCCTGTTTCTCAGGGG - Intergenic
1026979505 7:74518175-74518197 CTCCCTGAGCAGCCTCTCATAGG - Exonic
1033807869 7:144975311-144975333 CACCCCATCCTGCTTCTCATGGG - Intergenic
1033997816 7:147373721-147373743 CTCCCTGCTCTGGTTCTCAGTGG - Intronic
1034529774 7:151688460-151688482 CTCCCCACACCGCATCTCATCGG - Intronic
1045640178 8:104241107-104241129 CCCACTAAGCTGCTTCTAATAGG + Intronic
1048091845 8:131249917-131249939 CTCACAACTCTGCTTCGCATTGG - Intergenic
1054161188 9:61672935-61672957 CTGCCTACCCTGTTTCTCAGGGG - Intergenic
1055115250 9:72598776-72598798 CTTCCTACTGTTCTTCTCATGGG + Intronic
1059667586 9:116463365-116463387 CTCCCTAAGCTGGTTCACAAAGG + Intronic
1060213811 9:121726353-121726375 CTCCCTATGCATCTTTTCATTGG + Intronic
1189744642 X:44157503-44157525 CTCCTGATGCTGCTTCACATTGG - Intronic
1193644152 X:84046798-84046820 GTGCCTACGCTGCTTGTCATTGG - Intergenic
1198457261 X:136828804-136828826 TGCCCTTCGCTGCTCCTCATGGG - Intergenic
1200137281 X:153881326-153881348 CTCCCTAAGCTGCCTCTCAGAGG + Intronic