ID: 1119353090

View in Genome Browser
Species Human (GRCh38)
Location 14:73982368-73982390
Sequence AAATATATCTATTTTAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1010
Summary {0: 1, 1: 0, 2: 8, 3: 109, 4: 892}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119353090 Original CRISPR AAATATATCTATTTTAGGCT GGG (reversed) Intronic