ID: 1119356616

View in Genome Browser
Species Human (GRCh38)
Location 14:74012387-74012409
Sequence ATGAGCCACCGGTCCCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6351
Summary {0: 1, 1: 0, 2: 106, 3: 1153, 4: 5091}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119356606_1119356616 27 Left 1119356606 14:74012337-74012359 CCTCAAGTGATCCACCAGACTTC 0: 1
1: 5
2: 323
3: 7235
4: 37908
Right 1119356616 14:74012387-74012409 ATGAGCCACCGGTCCCAGCTGGG 0: 1
1: 0
2: 106
3: 1153
4: 5091
1119356611_1119356616 3 Left 1119356611 14:74012361-74012383 CCTCCTAAAGTGCTGGGATTATA 0: 872
1: 35777
2: 334417
3: 257751
4: 146024
Right 1119356616 14:74012387-74012409 ATGAGCCACCGGTCCCAGCTGGG 0: 1
1: 0
2: 106
3: 1153
4: 5091
1119356608_1119356616 13 Left 1119356608 14:74012351-74012373 CCAGACTTCGCCTCCTAAAGTGC 0: 1
1: 34
2: 2719
3: 76145
4: 265055
Right 1119356616 14:74012387-74012409 ATGAGCCACCGGTCCCAGCTGGG 0: 1
1: 0
2: 106
3: 1153
4: 5091
1119356613_1119356616 0 Left 1119356613 14:74012364-74012386 CCTAAAGTGCTGGGATTATAGGC 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
Right 1119356616 14:74012387-74012409 ATGAGCCACCGGTCCCAGCTGGG 0: 1
1: 0
2: 106
3: 1153
4: 5091
1119356607_1119356616 16 Left 1119356607 14:74012348-74012370 CCACCAGACTTCGCCTCCTAAAG 0: 1
1: 2
2: 100
3: 3947
4: 63987
Right 1119356616 14:74012387-74012409 ATGAGCCACCGGTCCCAGCTGGG 0: 1
1: 0
2: 106
3: 1153
4: 5091

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119356616 Original CRISPR ATGAGCCACCGGTCCCAGCT GGG Intronic
Too many off-targets to display for this crispr