ID: 1119357488 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:74019209-74019231 |
| Sequence | GCGGCGCCGGATCCTCTACG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 30 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 2, 4: 27} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1119357488_1119357493 | 19 | Left | 1119357488 | 14:74019209-74019231 | CCACGTAGAGGATCCGGCGCCGC | 0: 1 1: 0 2: 0 3: 2 4: 27 |
||
| Right | 1119357493 | 14:74019251-74019273 | GCGCGCGCGCCACCCTTGCGCGG | 0: 1 1: 0 2: 1 3: 2 4: 56 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1119357488 | Original CRISPR | GCGGCGCCGGATCCTCTACG TGG (reversed) | Intronic | ||