ID: 1119357493

View in Genome Browser
Species Human (GRCh38)
Location 14:74019251-74019273
Sequence GCGCGCGCGCCACCCTTGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 56}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119357489_1119357493 6 Left 1119357489 14:74019222-74019244 CCGGCGCCGCCGACACTCGCACA 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1119357493 14:74019251-74019273 GCGCGCGCGCCACCCTTGCGCGG 0: 1
1: 0
2: 1
3: 2
4: 56
1119357487_1119357493 20 Left 1119357487 14:74019208-74019230 CCCACGTAGAGGATCCGGCGCCG 0: 1
1: 0
2: 0
3: 0
4: 8
Right 1119357493 14:74019251-74019273 GCGCGCGCGCCACCCTTGCGCGG 0: 1
1: 0
2: 1
3: 2
4: 56
1119357483_1119357493 27 Left 1119357483 14:74019201-74019223 CCCGGGCCCCACGTAGAGGATCC 0: 1
1: 0
2: 2
3: 9
4: 118
Right 1119357493 14:74019251-74019273 GCGCGCGCGCCACCCTTGCGCGG 0: 1
1: 0
2: 1
3: 2
4: 56
1119357484_1119357493 26 Left 1119357484 14:74019202-74019224 CCGGGCCCCACGTAGAGGATCCG 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1119357493 14:74019251-74019273 GCGCGCGCGCCACCCTTGCGCGG 0: 1
1: 0
2: 1
3: 2
4: 56
1119357491_1119357493 -3 Left 1119357491 14:74019231-74019253 CCGACACTCGCACACTCACCGCG 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1119357493 14:74019251-74019273 GCGCGCGCGCCACCCTTGCGCGG 0: 1
1: 0
2: 1
3: 2
4: 56
1119357490_1119357493 0 Left 1119357490 14:74019228-74019250 CCGCCGACACTCGCACACTCACC 0: 1
1: 0
2: 1
3: 33
4: 361
Right 1119357493 14:74019251-74019273 GCGCGCGCGCCACCCTTGCGCGG 0: 1
1: 0
2: 1
3: 2
4: 56
1119357488_1119357493 19 Left 1119357488 14:74019209-74019231 CCACGTAGAGGATCCGGCGCCGC 0: 1
1: 0
2: 0
3: 2
4: 27
Right 1119357493 14:74019251-74019273 GCGCGCGCGCCACCCTTGCGCGG 0: 1
1: 0
2: 1
3: 2
4: 56
1119357486_1119357493 21 Left 1119357486 14:74019207-74019229 CCCCACGTAGAGGATCCGGCGCC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1119357493 14:74019251-74019273 GCGCGCGCGCCACCCTTGCGCGG 0: 1
1: 0
2: 1
3: 2
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119357493 Original CRISPR GCGCGCGCGCCACCCTTGCG CGG Exonic