ID: 1119362944

View in Genome Browser
Species Human (GRCh38)
Location 14:74067071-74067093
Sequence CACAGGTGCGGGCCACCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 0, 2: 8, 3: 89, 4: 370}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119362944_1119362948 -7 Left 1119362944 14:74067071-74067093 CCAGGTGGTGGCCCGCACCTGTG 0: 1
1: 0
2: 8
3: 89
4: 370
Right 1119362948 14:74067087-74067109 ACCTGTGGTCCAAGCTGCTCAGG 0: 1
1: 164
2: 4851
3: 48794
4: 179003
1119362944_1119362954 9 Left 1119362944 14:74067071-74067093 CCAGGTGGTGGCCCGCACCTGTG 0: 1
1: 0
2: 8
3: 89
4: 370
Right 1119362954 14:74067103-74067125 GCTCAGGAGGCTGAGGCAGGAGG 0: 231
1: 5686
2: 13820
3: 33724
4: 78204
1119362944_1119362950 -4 Left 1119362944 14:74067071-74067093 CCAGGTGGTGGCCCGCACCTGTG 0: 1
1: 0
2: 8
3: 89
4: 370
Right 1119362950 14:74067090-74067112 TGTGGTCCAAGCTGCTCAGGAGG 0: 3
1: 311
2: 7373
3: 61844
4: 185546
1119362944_1119362952 2 Left 1119362944 14:74067071-74067093 CCAGGTGGTGGCCCGCACCTGTG 0: 1
1: 0
2: 8
3: 89
4: 370
Right 1119362952 14:74067096-74067118 CCAAGCTGCTCAGGAGGCTGAGG 0: 26
1: 3718
2: 107719
3: 213660
4: 243861
1119362944_1119362953 6 Left 1119362944 14:74067071-74067093 CCAGGTGGTGGCCCGCACCTGTG 0: 1
1: 0
2: 8
3: 89
4: 370
Right 1119362953 14:74067100-74067122 GCTGCTCAGGAGGCTGAGGCAGG 0: 2224
1: 84335
2: 183383
3: 212836
4: 150147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119362944 Original CRISPR CACAGGTGCGGGCCACCACC TGG (reversed) Intronic
900288852 1:1915346-1915368 CAGAGGTGCGGCCCTCCAGCAGG - Intronic
900580539 1:3406452-3406474 TACAGGTGTGAGCCACCACCTGG - Intronic
900998959 1:6137934-6137956 CCCAGGTCCAGGCCCCCACCAGG - Intronic
901039898 1:6357571-6357593 CATGGCTGGGGGCCACCACCTGG + Intronic
901307060 1:8240309-8240331 TGCAGGTGCGAGCCACCACGTGG - Intergenic
902238099 1:15070546-15070568 CACAGGTGCGGGGCGGCTCCTGG - Intronic
902352713 1:15869726-15869748 TACAGGTGTGTGCCACCACGTGG + Intronic
903250175 1:22047642-22047664 TACAGGTGCTTGCCACCACACGG + Intergenic
903414565 1:23173094-23173116 TACAGGTGTGAGCCACCGCCAGG + Intronic
903523279 1:23972131-23972153 CACAGGTGTGAGCCACCACCCGG - Intronic
904040677 1:27583036-27583058 TACAGGTGCCTGCCACCACATGG + Intronic
904156148 1:28484823-28484845 TACAGGTGCCTGCCACCACCCGG - Intronic
905564899 1:38956370-38956392 TACAGGTGCGTGCCACCACGGGG + Intergenic
905598481 1:39229883-39229905 TACAGGTGCACACCACCACCTGG + Intronic
905698173 1:39991353-39991375 TACAGGTGTGAGCCACCACCCGG - Intergenic
905783118 1:40730149-40730171 CACAGGTGCATGCCATCAGCAGG + Intronic
906088595 1:43157608-43157630 TACAGGCGTGAGCCACCACCCGG - Intergenic
906225312 1:44117235-44117257 CCCAGGAGTGGGGCACCACCAGG - Intergenic
906232782 1:44179938-44179960 TACAGGTGTGAGCCACCACCCGG + Intergenic
906539099 1:46571399-46571421 TACAGGTGTGTGCCACCACCTGG - Exonic
906793422 1:48678187-48678209 CACAGCTGCTGGCCACAGCCAGG + Intronic
907405514 1:54251388-54251410 CAGAGTTGAGGGCCCCCACCAGG - Intronic
908225268 1:62049973-62049995 TACAGGTGCATGCCACCACACGG - Intronic
909429019 1:75564758-75564780 TACAGGTGACCGCCACCACCAGG + Intronic
910247842 1:85161448-85161470 TACAGGCGTGAGCCACCACCTGG - Intronic
911013409 1:93305895-93305917 TACAGGTGTGAGCCACCACATGG - Intergenic
914840053 1:151241020-151241042 TACAGGTGCTCACCACCACCCGG - Intronic
915172586 1:153988432-153988454 TACAGGCGCCCGCCACCACCCGG + Intergenic
915524974 1:156470276-156470298 TACAGGTGCGCGCCACCGCCTGG - Intronic
915616551 1:157043872-157043894 CAGAGGCGTGGGCCTCCACCAGG - Intronic
916548811 1:165830277-165830299 TACAGGTGTGAGCCACTACCTGG + Intronic
916665504 1:166963495-166963517 CACAGGTCCTCACCACCACCTGG + Intronic
916738162 1:167626932-167626954 TACAGGTGTGAGCTACCACCTGG + Intergenic
917688031 1:177438049-177438071 TACAGGTGCCTGCCACCAGCTGG + Intergenic
918342476 1:183578991-183579013 CCCAGGTGTGAGCCACAACCAGG - Intronic
918376964 1:183918766-183918788 GAAAGGTGAGTGCCACCACCTGG - Intronic
918452813 1:184676055-184676077 TACAGGCGCCCGCCACCACCTGG + Intergenic
918913047 1:190598170-190598192 TACAGGTGCCTGCCACAACCTGG - Intergenic
919258850 1:195162793-195162815 CACAAGTGTGTGCCACCACCAGG + Intergenic
922251625 1:223854442-223854464 TACAGGTGCGAGCCACCGCCCGG - Intergenic
922951384 1:229560607-229560629 TACAGGTGTGAGCCACCGCCTGG - Intergenic
923128115 1:231050104-231050126 TACAGGTACCCGCCACCACCCGG + Intergenic
924411831 1:243813958-243813980 TACAGGTGTGCACCACCACCTGG - Intronic
924662409 1:246033508-246033530 TACAGGTGTGAGCCAGCACCCGG - Intronic
924738047 1:246776975-246776997 CACAGGTGAAGGCCACATCCTGG - Intergenic
1063079770 10:2754801-2754823 CCCAGGTGATGACCACCACCTGG - Intergenic
1063145307 10:3290494-3290516 CCCAGGTGAGGGCCAGCACATGG - Intergenic
1065013178 10:21437781-21437803 TACAGGCGTGAGCCACCACCCGG + Intergenic
1065619949 10:27570694-27570716 TACAGGTGCATGCCACCACATGG - Intergenic
1066659563 10:37727024-37727046 TACAGGTGTGAGCCACCACATGG + Intergenic
1067751314 10:48973610-48973632 CACATGTGCTTGCCATCACCTGG - Intronic
1068910258 10:62372517-62372539 TACAGGTCCCTGCCACCACCCGG - Intergenic
1069614660 10:69799434-69799456 CATAGGTGGGGGCCAGGACCTGG - Intergenic
1069711576 10:70492730-70492752 TACAGGTGTGAGCCACCACCTGG + Intronic
1069859697 10:71462708-71462730 CACAGGGCCTGGCCCCCACCAGG + Intronic
1070294202 10:75145218-75145240 TACAGGCGTGAGCCACCACCTGG + Intronic
1070924978 10:80214143-80214165 CACAGCTAGGGGTCACCACCTGG + Intergenic
1071091933 10:81929100-81929122 TACAGGTGTGAGCCACCACAGGG + Intronic
1071805212 10:89111988-89112010 TACAGGTGTGCGCCACCACGTGG + Intergenic
1072608765 10:97003219-97003241 CGCAGCAGCTGGCCACCACCAGG - Intronic
1072659903 10:97357306-97357328 TTCATGTGCTGGCCACCACCTGG - Intronic
1073518897 10:104106602-104106624 CACAGGTGCGGGGCAGAACTGGG - Intergenic
1074169409 10:110918697-110918719 CACGGGGGCGGGCCGCCGCCAGG + Intronic
1076421906 10:130337883-130337905 CACAGGTGCCGGCCACTCCAAGG + Intergenic
1076610583 10:131723541-131723563 CCCAGGTGGGGGCCACCACCAGG - Intergenic
1076721817 10:132396452-132396474 CCCCGGTGCCGGCCACCCCCAGG + Intergenic
1076796103 10:132799217-132799239 CTCAGGTGCGGGCCTACACTGGG - Intergenic
1076986591 11:241105-241127 TACAGGTGTGAACCACCACCTGG + Intronic
1077075041 11:696623-696645 CACAGGGGTGCGCCACCGCCTGG - Intronic
1078233956 11:9467032-9467054 TACAGGTGCATGCCACCGCCTGG + Intronic
1078930019 11:15905625-15905647 CACAGGCGCTGGCCACCGCCTGG + Intergenic
1080653290 11:34239604-34239626 TACAGGTCTGAGCCACCACCCGG + Intronic
1080947636 11:36992916-36992938 TACAGGCGTGAGCCACCACCCGG - Intergenic
1081092324 11:38887563-38887585 TACAGGTGTGAGCCACCACCTGG + Intergenic
1082200141 11:49357052-49357074 TACAGGTGCGTGCCACCACGCGG + Intergenic
1082232430 11:49783974-49783996 CACAGAAGTAGGCCACCACCCGG - Intergenic
1083656051 11:64230316-64230338 GACAGGCGCGGGCGCCCACCTGG - Exonic
1084015872 11:66381214-66381236 TACAGGCGCCCGCCACCACCAGG + Intergenic
1084181016 11:67445936-67445958 TACAGGTGTGAGCCACCACCCGG + Intergenic
1084271172 11:68029971-68029993 CACAGTCGCCTGCCACCACCAGG - Intergenic
1084338304 11:68475495-68475517 CAGAGGTGCCCGCCACCTCCCGG + Intronic
1084639105 11:70413975-70413997 CACAGGTCGGGGCCACCAGTGGG - Intronic
1085252987 11:75155731-75155753 TACAGGTGTGAGCCACCACGAGG + Intronic
1086618202 11:88849982-88850004 CACAGAAGCAGGCCACCACCCGG + Exonic
1086958323 11:92957069-92957091 TACAGGTGTGCACCACCACCTGG + Intergenic
1087016555 11:93559835-93559857 CCCAGGTGAGGCCCAGCACCAGG + Intergenic
1088366005 11:109040613-109040635 TACAGGTGTGAGCCACCACCTGG - Intergenic
1088622322 11:111698464-111698486 TACAGGTGTGAGCCACCACCTGG - Intronic
1090270748 11:125384408-125384430 TACAGGCGTGAGCCACCACCCGG - Intronic
1091732754 12:2893005-2893027 CACAGGTGCGTGGCACCACCTGG + Intronic
1092070018 12:5624659-5624681 CACAGCTGGGGCCCAACACCAGG - Intronic
1092349540 12:7744883-7744905 CACAGGTGTGAGCCACTGCCTGG + Intronic
1092640892 12:10507731-10507753 TACAGGTGTGTGCCACCACACGG + Intronic
1094638272 12:32247940-32247962 TACAGGTGCGCACCACCACGTGG - Intronic
1094685370 12:32707808-32707830 TACAGGTGCATGCCACCACGCGG - Intronic
1095328801 12:40931961-40931983 AACAGGTGAGGGCCAACACTAGG - Intronic
1096476676 12:51913124-51913146 CACACGTGCAGGTCACCAGCGGG - Exonic
1096662975 12:53140496-53140518 TACAGGTGCGAGCCACTGCCTGG + Intergenic
1097873058 12:64617696-64617718 TACAGGTGCGTGCCACCACATGG + Intronic
1098337539 12:69419495-69419517 TACAGGTGTGAGCCACCACCTGG + Intergenic
1098716962 12:73841357-73841379 TACAGGTGTGAGCCACCACCCGG - Intergenic
1100985450 12:100198826-100198848 CACAGGTGCAGGCCCACGCCTGG - Intergenic
1101372016 12:104138487-104138509 CACAGGCCCGGGTCAGCACCGGG - Intergenic
1102393966 12:112572779-112572801 CACAGGTGCATGCCAACCCCCGG + Intronic
1102501478 12:113355947-113355969 CACAGGCACATGCCACCACCCGG + Intronic
1103645418 12:122388492-122388514 TACAGGCGTGAGCCACCACCCGG + Intronic
1103651454 12:122436090-122436112 TACAGGTGCATGCCACCACACGG + Intergenic
1103912837 12:124361671-124361693 CACAGATGGGGCCCAGCACCCGG - Intronic
1104284767 12:127414866-127414888 CACAGGTGCGGCTCACAGCCAGG - Intergenic
1104676558 12:130715440-130715462 CAGATGTCCGGGCCCCCACCTGG + Intronic
1104824093 12:131696002-131696024 CACACGTGGGGGCCACACCCAGG - Intergenic
1105382331 13:19899091-19899113 TACAGGCGCGTGCCACCACACGG + Intergenic
1106084146 13:26525226-26525248 TACAGGTGCGAGCCACCGCCTGG + Intergenic
1106140675 13:27008296-27008318 CACAGGTGCGCTCCACCATATGG - Intergenic
1107582655 13:41807819-41807841 CCCAGGAGCGGGGAACCACCAGG + Intronic
1108844084 13:54657354-54657376 TACAGGTGTGAGCCACCACACGG + Intergenic
1110167911 13:72465953-72465975 TACAGGTGCATGCCACCACGTGG + Intergenic
1110639170 13:77802188-77802210 TACAGGTGTGAGCCACCACCTGG - Intergenic
1112442611 13:99435183-99435205 AACAGGTGCGCGCCACCATGTGG + Intergenic
1112545469 13:100364906-100364928 TACAGGTGTGCGCCACCACCAGG - Intronic
1113416391 13:110131674-110131696 CTGAGGTGCGGGCCGCCTCCCGG + Intergenic
1114511928 14:23269454-23269476 TACAGGTGGGAGCCACTACCGGG - Intronic
1115237549 14:31222275-31222297 AACAGGTGCATGCCACCACACGG - Intergenic
1115800903 14:36992263-36992285 CACAGGTGCATACCACTACCAGG - Intronic
1115944927 14:38649011-38649033 TACACGTGCCTGCCACCACCCGG - Intergenic
1116110305 14:40570916-40570938 TACAGGTGCATGCCACCACCTGG + Intergenic
1116254617 14:42535527-42535549 TACAGGTGTGTGCCAACACCCGG - Intergenic
1116438585 14:44923387-44923409 TACAGGTGTGGGCCACCACCTGG - Intergenic
1117298255 14:54397853-54397875 TACAGGCGCGAGACACCACCCGG - Intronic
1119238651 14:73040750-73040772 CCCAGGAGCGGGAAACCACCAGG - Intergenic
1119362944 14:74067071-74067093 CACAGGTGCGGGCCACCACCTGG - Intronic
1119458374 14:74776913-74776935 CACAGGTATGTGCCACCATCTGG - Intronic
1121284394 14:92724005-92724027 TATAGGTGTGAGCCACCACCCGG + Intronic
1121925601 14:97924484-97924506 CCCAGGTTCCCGCCACCACCAGG + Intergenic
1125858558 15:42975169-42975191 TACAGGTGTGAGCCACCACCCGG + Intronic
1127784497 15:62343639-62343661 CACAGGTGCGGGCCGGCTCTGGG + Intergenic
1128867387 15:71124926-71124948 CACAGGTGCACACCACCAGCTGG - Intronic
1129210063 15:74063252-74063274 TACAGGCACGTGCCACCACCAGG - Intergenic
1129476971 15:75792179-75792201 TACAGGCACGTGCCACCACCAGG + Intergenic
1129597646 15:76977046-76977068 CCCAGGAGCGGGGGACCACCAGG - Intergenic
1130117962 15:81022012-81022034 TACAGGTGCAGGCTACCACATGG + Intronic
1131211827 15:90504188-90504210 TACAGGTGCGCACCACCACGCGG - Intergenic
1132781754 16:1630425-1630447 TACAGGCACGAGCCACCACCTGG + Intronic
1133113766 16:3564595-3564617 CACAGGTGGAGGCCACCCGCGGG - Exonic
1134215533 16:12314126-12314148 CACAGGTGCATGCCACCAGCAGG + Intronic
1135280359 16:21149086-21149108 TACAGGTGTGCGCCACCGCCTGG - Intronic
1135935255 16:26774510-26774532 TACAGGTGTGTGCCACCACATGG + Intergenic
1136054912 16:27681105-27681127 TACAGGTGTGAGCCACCGCCTGG + Intronic
1136109460 16:28055610-28055632 TACAGCTGCCTGCCACCACCCGG + Intronic
1136137514 16:28265831-28265853 TACAGGTGCGTACCACCACGCGG - Intergenic
1136234805 16:28906816-28906838 TACAGGCGCCGGCCACCAGCTGG - Intronic
1136409524 16:30068203-30068225 TACAGGCGCCCGCCACCACCCGG + Intronic
1136489773 16:30599417-30599439 TACAGGTGTGTGCCACCACCTGG + Intergenic
1136522330 16:30805243-30805265 CACAGGCGCGCGCCACCACGCGG + Intergenic
1137265303 16:46864280-46864302 TACAGGTGTGAGCCACCTCCTGG - Intergenic
1138425280 16:56927977-56927999 TACAGGTGCGAGCCACCACCTGG - Intergenic
1139658711 16:68405407-68405429 CACGGGTGTGTGCCACCACGTGG - Intronic
1139740749 16:69033043-69033065 TACAGGTGCCTGCCACCACACGG - Intronic
1139763401 16:69206135-69206157 TACAGGAGCGTGCCACCACTTGG + Intronic
1140184215 16:72752244-72752266 TACAGGCGTGAGCCACCACCTGG + Intergenic
1140512875 16:75520734-75520756 TACAGGTGCCTGCCACCACCTGG - Intergenic
1141146624 16:81535223-81535245 TACAGGTGTGAGCCACCACGTGG + Intronic
1141513250 16:84526036-84526058 TACAGGTGCACGCCACCACACGG + Intronic
1141571263 16:84934995-84935017 TACAGGTGCGAGCCACCCCGTGG - Intergenic
1141760156 16:86022870-86022892 ACCAGATGCAGGCCACCACCTGG - Intergenic
1142230776 16:88899287-88899309 CAGGGGTGCGGCCAACCACCTGG + Intronic
1142657940 17:1406658-1406680 TACAGGTGCATGCCAACACCTGG - Intergenic
1142728756 17:1836250-1836272 TACAGGTGCACGCCACCACCTGG + Intronic
1142729281 17:1840559-1840581 TACAGGCGTGAGCCACCACCTGG + Intronic
1142766766 17:2068775-2068797 CACCGATGAGGGGCACCACCAGG + Exonic
1143168325 17:4910450-4910472 TACAGGTGCATGCCACCAACCGG - Intergenic
1143438759 17:6951555-6951577 CACAGGTGAGTGAAACCACCCGG + Intronic
1143704317 17:8686636-8686658 TACAGGTATGAGCCACCACCCGG + Intergenic
1143853024 17:9827010-9827032 TACAGGTACGTGCCACCACCCGG + Intronic
1144265535 17:13564862-13564884 TACAGGTGCATGCCACCACCCGG + Intronic
1144563183 17:16338671-16338693 TACAGGTGTGTGCCACCCCCTGG - Intronic
1144697198 17:17312992-17313014 TACAGGTGTGAGCCAGCACCCGG - Intronic
1146110692 17:30086468-30086490 TACAGGTGTGAGCCACCACCTGG - Intronic
1146178513 17:30682299-30682321 CACAGGTGTGCGCCACCCACTGG + Intergenic
1146606573 17:34263583-34263605 TACAGGCACGCGCCACCACCCGG + Intergenic
1146702825 17:34976665-34976687 TACAGGTGCACGCCACCACCTGG + Intronic
1146995649 17:37318381-37318403 TACAGGTGCTCGCCACCACCTGG + Intronic
1147355683 17:39894506-39894528 TACAGGTGCCTGCCACCACATGG + Intergenic
1147565655 17:41535067-41535089 CACAGATCCACGCCACCACCTGG - Intergenic
1147767729 17:42848118-42848140 CCCAGGTGCTGGACACCAGCTGG - Intronic
1147912666 17:43865515-43865537 TACAGGTGTGAGCCACCACGCGG + Intergenic
1148158385 17:45436328-45436350 CACAGGTGTGTGCCATGACCGGG + Exonic
1148221213 17:45863720-45863742 TACAGGTGTGAGCCACCAACAGG + Intergenic
1149309068 17:55376731-55376753 CACAGGTGCATACCACCACTCGG - Intergenic
1149602964 17:57904871-57904893 CACAGGGGCAGGCCACCCACCGG + Intronic
1149870007 17:60172566-60172588 TACAGGTGTGAGCCACCACACGG - Intergenic
1150077842 17:62208331-62208353 GACAGGTAAGAGCCACCACCCGG + Intergenic
1150389803 17:64783721-64783743 CACAGGTGTGCGCCATGACCGGG + Intergenic
1151515660 17:74593546-74593568 TACAGGCGTGTGCCACCACCTGG - Exonic
1151590630 17:75041862-75041884 CCCAGGAGCGGGGGACCACCAGG + Intronic
1151718572 17:75843645-75843667 AACAGGTGCGGGGCATCACTGGG - Intronic
1151901006 17:77015026-77015048 TACAGGTGTGAGCCACCGCCTGG - Intergenic
1152194697 17:78910466-78910488 TAAAGGTGTGGGCCACCGCCTGG + Intronic
1152221522 17:79070992-79071014 TACAGGCGCATGCCACCACCTGG + Intergenic
1152612490 17:81322644-81322666 GACAGGCGTCGGCCACCACCCGG - Intronic
1153687781 18:7564071-7564093 TACAGGTGTGAGCCACCACATGG + Intergenic
1154091418 18:11367363-11367385 CACAGGTGATGGCCACCATTTGG + Intergenic
1154218684 18:12433843-12433865 CACAGGTGTGTGCCACCGCTTGG + Intergenic
1156874701 18:41994895-41994917 TACAGGTACGTGCCACTACCTGG - Intronic
1158241193 18:55380155-55380177 TACAGGTGTGAGCCACCACGAGG + Intronic
1158952331 18:62505803-62505825 GACAGGGACGGGACACCACCAGG - Intergenic
1159511436 18:69401456-69401478 GGCAGGTGTGGGCCCCCACCTGG - Intronic
1160743339 19:698037-698059 CACAGGCACCTGCCACCACCAGG + Intergenic
1160898537 19:1414959-1414981 TACAGGTGCCTGCCACCACCTGG + Intronic
1160980779 19:1815725-1815747 CAGAGGTGCCGGCCACCACCCGG + Exonic
1160989708 19:1855501-1855523 GGCAGGGGCGGGCCACCACCCGG + Intronic
1161080792 19:2309010-2309032 GACAGGTGTGAGCCACCGCCCGG + Intronic
1161507911 19:4653990-4654012 CAATGATGCCGGCCACCACCAGG + Exonic
1162137678 19:8565811-8565833 GACAGGTGTGAGCCACCACCCGG - Intronic
1162692132 19:12441519-12441541 TACAGGCACGCGCCACCACCCGG + Intronic
1162980100 19:14233267-14233289 CACAGGTGTGCGCCACCCACTGG - Intergenic
1162996557 19:14339513-14339535 TACAGGTGCACACCACCACCTGG + Intergenic
1163246773 19:16100675-16100697 TGCAGGTGCATGCCACCACCTGG - Intronic
1163666187 19:18605215-18605237 CACAGGCGCTGCCCACCGCCTGG + Intronic
1163765254 19:19160243-19160265 TACAGGTGTGAGCCACCACACGG + Intronic
1163837663 19:19584895-19584917 TACAGGCGCGAGCCACCTCCTGG + Intronic
1164454476 19:28395805-28395827 TACAGGTGTGCACCACCACCTGG - Intergenic
1164935308 19:32205709-32205731 TACAGGTGCCTGCCACCGCCTGG - Intergenic
1165016033 19:32880496-32880518 TACAGGTGCATGCCACCACGTGG - Intronic
1165322944 19:35097408-35097430 TACAGGTGTGCACCACCACCAGG - Intergenic
1165458232 19:35927509-35927531 CACAGGCGTGAGCCACCACGTGG + Intergenic
1165939457 19:39407898-39407920 CACAGCTGCGGCCCTCCACTAGG - Exonic
1166056134 19:40290104-40290126 TACAGGTGCCTGCCACCTCCCGG - Intergenic
1166395594 19:42438081-42438103 TACAGGTGTGAGCCCCCACCTGG - Intronic
1166592589 19:44014127-44014149 TACAGGCGCCCGCCACCACCTGG - Intergenic
1166719477 19:44988903-44988925 TACAGGCGAGAGCCACCACCAGG - Intronic
1166817735 19:45557003-45557025 CCCAGCTCTGGGCCACCACCAGG - Intronic
1167886469 19:52504069-52504091 TACAGGTGAGAGCCACCGCCTGG + Intronic
1168697630 19:58413774-58413796 TACAGGCGTGAGCCACCACCCGG + Intronic
1168708654 19:58484554-58484576 TACAGGTGTGAGCCACCACATGG - Intronic
925090503 2:1151312-1151334 CACAGGAGTGGGACACCCCCCGG - Intronic
925126490 2:1461049-1461071 GACAGTTGGGGGCCACCATCTGG + Intronic
925300193 2:2806316-2806338 CACACGGCCGGGCCACCCCCCGG + Intergenic
925792899 2:7510800-7510822 CACAGCTGTGGGCCACCACATGG - Intergenic
927828627 2:26328592-26328614 CACAGGTGCATGCCCACACCCGG + Intronic
927892433 2:26760223-26760245 AACAGGTGTGAGCCACCACACGG + Intergenic
928895246 2:36254639-36254661 TACAGGTGCGTGCCACCACCTGG + Intergenic
929600051 2:43199273-43199295 TACAGGTGTGAGCCACCACGGGG + Intergenic
929605394 2:43230685-43230707 CCCAGGTGCAGGCCACCTGCAGG - Intergenic
930638786 2:53834423-53834445 TACAGGCGTGGGCCACCGCCCGG - Intergenic
930771688 2:55136314-55136336 CACAGTTGCCTGCCAGCACCTGG - Intergenic
931480036 2:62630621-62630643 CAGAGGTGCCGCCCACCTCCCGG - Intergenic
931821539 2:65957032-65957054 GACAAGTAAGGGCCACCACCAGG + Intergenic
931978143 2:67666031-67666053 TACAGGCGCCCGCCACCACCCGG + Intergenic
932612728 2:73211740-73211762 TACATGTGTGAGCCACCACCCGG + Exonic
933794616 2:85909580-85909602 TACAAGTGCGAGCCACCGCCTGG - Intergenic
934520301 2:95016077-95016099 TACAGGTGCGAGCCCGCACCTGG - Intergenic
935300964 2:101693667-101693689 TACAGGTGCGAACCACCACCAGG + Intergenic
935321185 2:101890899-101890921 TACAGGTGTGTGCCACCACATGG + Intronic
935759792 2:106310374-106310396 TACAGGTGTGAGCCACCGCCTGG + Intergenic
938033249 2:128013787-128013809 TACAGGTGTGAGCCACCACATGG - Intronic
938978827 2:136506429-136506451 CACAGGTGCCTGCCACAACCTGG - Intergenic
940009751 2:149040364-149040386 TACAGGCGCCGGCCACCACGTGG + Intronic
942426674 2:175867712-175867734 TACAGGTGTGAGCCACCATCCGG - Intergenic
942438721 2:176009095-176009117 TACAGGTGTGAGCCACCACGTGG - Intergenic
944510984 2:200465755-200465777 TACAGGTGTGAGCCATCACCTGG - Intronic
944710815 2:202333580-202333602 CCCAGGAGCGGGGGACCACCAGG + Intergenic
944767013 2:202874023-202874045 TACAGGTGCACGCCACCACATGG - Intergenic
946209152 2:218133572-218133594 TACAGGTGTGAGCCACCACTGGG + Intronic
948304552 2:236936697-236936719 CAGAGCTGCTGGCCACCCCCAGG + Intergenic
948437795 2:237966004-237966026 TACAGGCGCGCGCCACCACGCGG + Intergenic
948858040 2:240739645-240739667 CCAAGATGCTGGCCACCACCAGG + Intronic
1169193148 20:3670253-3670275 GACAGGGGCAGGGCACCACCTGG - Intronic
1169923159 20:10756674-10756696 TACAGGTGCCTGCCACCACACGG - Intergenic
1171289726 20:23975380-23975402 CAGGGGTGGGGGCCAGCACCAGG + Intergenic
1172109357 20:32536346-32536368 CCCAGGTGCGGGCCCCACCCAGG + Intronic
1173977255 20:47196396-47196418 CACAGGTCCGTGCCACAACATGG - Intergenic
1174133022 20:48359362-48359384 CACAGGTGCAGGCCTGCTCCTGG + Intergenic
1174623757 20:51897281-51897303 TACAGGTGTGCACCACCACCTGG - Intergenic
1175905196 20:62376222-62376244 TACAGGTGTGAGCCACCGCCTGG + Intergenic
1175965651 20:62658870-62658892 CGCAGGTGCTGGGCACCCCCCGG + Intronic
1176186492 20:63782825-63782847 CACAGGTGTGAGCCACTGCCTGG - Intronic
1176189969 20:63803846-63803868 CACAGGGGCACGCCACCACACGG + Intronic
1177455414 21:21331727-21331749 CACAGGCACGTGCCACCACATGG + Intronic
1178145606 21:29736369-29736391 CACAGGTGCATGCTACCACCTGG + Intronic
1179571484 21:42281249-42281271 CCCAGGGGCCGGCCACCACAGGG + Intronic
1179811115 21:43870434-43870456 TACAGGTGTGAACCACCACCCGG - Intronic
1179831866 21:44001868-44001890 CACAGATGAGGGCCTCCAGCAGG + Intergenic
1180714123 22:17859846-17859868 CTCAGGTGCAGTCCACCAGCAGG - Intronic
1180943951 22:19679524-19679546 CCCAGGTGTGGGACACCAGCTGG - Intergenic
1181017394 22:20079236-20079258 CACAGGCGCCCGCCACCACGCGG + Intergenic
1182448558 22:30404311-30404333 CACAGGTGCCGGACACGTCCTGG - Intronic
1183069173 22:35384357-35384379 TAGAGGTGTGAGCCACCACCCGG + Intronic
1183422608 22:37720786-37720808 TACAGGTGTGAGCCACTACCAGG + Intronic
1183706784 22:39479196-39479218 TACAGGTGTGTGCCACCACTCGG - Intronic
1183861171 22:40671308-40671330 TACAGGTGCCCGTCACCACCCGG + Intergenic
1183977107 22:41518656-41518678 TACAGCTGTGAGCCACCACCCGG - Intronic
1184042109 22:41950420-41950442 TACAGGCGTGAGCCACCACCTGG - Intergenic
1184085599 22:42261716-42261738 TACAGGTGTGAGCCACCATCTGG - Intronic
1184728542 22:46359912-46359934 CACAGATTAGGGCCACCCCCGGG - Intergenic
1185396195 22:50590833-50590855 TACAGGTGTGTGCCACCACCTGG + Intronic
1185412874 22:50695141-50695163 CACAGGTGCTAGGCACCACCAGG - Intergenic
949262027 3:2114175-2114197 TACAGGTGTGAGCCACCACCTGG - Intronic
949307488 3:2659184-2659206 TACAGGTCTGAGCCACCACCTGG - Intronic
949552438 3:5122383-5122405 CACACGAGCGGGCCTCCGCCCGG - Exonic
950027360 3:9829341-9829363 CACAGTTGCGGTCCAGCATCCGG - Exonic
950441590 3:13014010-13014032 CACAGGTGTGGGCAGCCACCTGG + Intronic
950497068 3:13340182-13340204 CCCCAGTGCAGGCCACCACCTGG - Intronic
950770597 3:15307786-15307808 CACTGGCACTGGCCACCACCAGG - Intronic
951339169 3:21463479-21463501 CCCAGGTGTGTGCCTCCACCTGG - Intronic
952309078 3:32170831-32170853 CACAGGTGTGTGCCACCACTGGG - Intergenic
953497390 3:43399940-43399962 AACAGGAGCAGGCCAGCACCTGG - Intronic
953643720 3:44733582-44733604 CAAAGGTGAGGGCCAGCACCTGG + Intronic
954071541 3:48146482-48146504 TACAGGTGTGAGCCGCCACCTGG + Intergenic
954956627 3:54526964-54526986 TACAGGTGTGAGCCACCACGTGG + Intronic
955916873 3:63915208-63915230 TACAGGTGTGAGCCACCGCCTGG + Intronic
957855374 3:85869797-85869819 TACAGGTGCCCGCCACCACGGGG + Intronic
958500672 3:94904340-94904362 CACAGCTGAGGGCCTCCTCCTGG - Intergenic
962348473 3:134639807-134639829 CACAGGTGAGTGCCACCACATGG - Intronic
963785442 3:149530070-149530092 TACAGGTGTGAGCCACCGCCCGG - Intronic
963946589 3:151152375-151152397 TACAGGTGTGAGCCACCGCCTGG + Intronic
965030475 3:163359170-163359192 TACAGGCACGTGCCACCACCTGG - Intergenic
965527662 3:169738773-169738795 TACAGGCGTGAGCCACCACCTGG + Intergenic
966842869 3:184103654-184103676 TACAGGTGTGTGCCACCATCTGG - Intronic
967022078 3:185531603-185531625 TACAGGTGTGAGCCACCAGCTGG - Intronic
967246203 3:187489650-187489672 TACAGGTGTGTACCACCACCTGG + Intergenic
968130398 3:196189763-196189785 CTCAGGGCCGGGCCACGACCAGG + Intergenic
968192091 3:196675925-196675947 GACAGGCGTGAGCCACCACCTGG + Intronic
968317347 3:197736286-197736308 GACAGGGGCAGGGCACCACCCGG - Intronic
968804875 4:2765945-2765967 TACAGGTGTGAGCCACCGCCTGG + Intergenic
969057495 4:4410996-4411018 TATAGGTGTGCGCCACCACCCGG + Intronic
969527275 4:7710264-7710286 CACAGCTTCAGGCCACCTCCTGG - Intronic
971330669 4:25678654-25678676 CACAGGCGTGAGCCACCACCAGG + Exonic
971390702 4:26182772-26182794 TACCGGTGTGAGCCACCACCCGG + Intronic
972533809 4:39983086-39983108 TACAGGTGCCCGCCACCACCCGG + Intergenic
972624237 4:40780464-40780486 CACAGGTGTGTGCTACCACCTGG - Intronic
973271015 4:48263436-48263458 TACAGGTGTGAGCCACCGCCTGG - Intronic
973811134 4:54571358-54571380 CACAGGTGCTGGCCGCCAGCAGG + Intergenic
973830135 4:54750873-54750895 CACAGGTGAGAGCCACCATGTGG - Intergenic
974297831 4:60025577-60025599 TACAGGTGTGAGCCACCACCTGG + Intergenic
975134077 4:70857266-70857288 CACAGGTGTATGCCACCACTTGG - Intergenic
975542438 4:75528771-75528793 TACAGGTATGAGCCACCACCCGG - Exonic
975547058 4:75570675-75570697 TACAGGTGTGTGCCACCACATGG - Intergenic
977371950 4:96148692-96148714 TACAGGTGCCTGCCACCACTGGG - Intergenic
978926555 4:114252272-114252294 CACACATGCTGGCCACCAGCAGG - Intergenic
982361455 4:154523804-154523826 TACAGGCGCCTGCCACCACCTGG + Intergenic
983054084 4:163081816-163081838 TACAGGTGGATGCCACCACCTGG - Intergenic
983565439 4:169145721-169145743 TACAGGTGTGAGCCACCGCCTGG + Intronic
983565479 4:169146501-169146523 TACAGGTGTGAGCCACCACCCGG + Intronic
983796348 4:171868820-171868842 TACAGGCGTGGGCCCCCACCTGG + Intronic
983819167 4:172171695-172171717 CACAGACACGTGCCACCACCCGG - Intronic
985550244 5:529035-529057 CACAGGCGAGCGCCACCACTCGG - Intergenic
987378516 5:17260898-17260920 TACAGGTGTTAGCCACCACCAGG - Intronic
987664474 5:20919424-20919446 TACAGGTGTGAGCCACCACCCGG - Intergenic
988758207 5:34282768-34282790 TACAGGCGTGAGCCACCACCCGG + Intergenic
989024500 5:37050968-37050990 TACAGGTGTGCGCCACCACCTGG + Intronic
989291333 5:39769613-39769635 TACAGGTGCGTGCCACCACACGG + Intergenic
990845533 5:60134362-60134384 CACATGTGTGGGCCACCACCTGG - Intronic
992902156 5:81307852-81307874 TACAGGTGTGTACCACCACCTGG - Intronic
994702327 5:103150628-103150650 TACAGGTGTGAGCCACCACAAGG - Intronic
995792082 5:115899561-115899583 TACAGGTGTGAGCCACCACCTGG + Intronic
998223298 5:140305853-140305875 TACAGGTGCATGTCACCACCTGG + Intergenic
999325763 5:150642442-150642464 CACAAGTGCAGGCCACAGCCAGG + Intronic
1000332964 5:160220332-160220354 TACAGGTGTGAGCCATCACCTGG - Intronic
1001387349 5:171350790-171350812 TACAGGCGTGAGCCACCACCTGG + Intergenic
1001844014 5:174904663-174904685 GAGAGGAGAGGGCCACCACCTGG + Intergenic
1002259203 5:177982383-177982405 CACTGCTGCTGCCCACCACCCGG + Intergenic
1003139032 6:3456366-3456388 CTCGGGTGCGGGCCGCCTCCAGG + Exonic
1003279514 6:4679323-4679345 CACAGGAGAGGTCCACCTCCAGG - Intergenic
1005561870 6:27048710-27048732 TACAGGTGTGAGCCACCATCTGG + Intergenic
1007574119 6:42913900-42913922 CACAGGCGTGCGCCACCACCTGG - Intergenic
1007862786 6:44930653-44930675 CTCAGGAGGGGACCACCACCTGG - Intronic
1011635958 6:89373475-89373497 TACAGGTGTGCGCCACCACGTGG - Intronic
1012850961 6:104446338-104446360 GAGAGGTGCGGGCCAGAACCGGG + Intergenic
1013006479 6:106079099-106079121 TACAGGTGCCCGCCACCACGTGG + Intergenic
1013061206 6:106635728-106635750 TACAGGCGTGTGCCACCACCTGG - Intronic
1013213484 6:108007025-108007047 TACAGGTGTGAGCCACCGCCTGG + Intergenic
1013298220 6:108779184-108779206 TACAGGCGTGAGCCACCACCTGG - Intergenic
1017839909 6:158212920-158212942 TACAGGTGCCCGCCACCACGTGG - Intergenic
1018273505 6:162105540-162105562 TACAGGCGTGTGCCACCACCTGG + Intronic
1018283739 6:162215768-162215790 CACAGGTGTGAGCCACCGCCCGG - Intronic
1019421356 7:952786-952808 CAGAGGTGCGGCCCTCTACCCGG + Intronic
1020025402 7:4896202-4896224 TAAAGGTGTGAGCCACCACCTGG - Intergenic
1020890271 7:13869468-13869490 TACAGGTGTGAGCCACCACCTGG + Intergenic
1021076204 7:16307537-16307559 CACAGGTGCCTACCACCACCCGG - Intronic
1022015329 7:26344442-26344464 TACAGGTGTGAGCCACCACCTGG + Intronic
1022429062 7:30298003-30298025 CACAGGTGCATGCCACCATAGGG + Intronic
1022746552 7:33178556-33178578 CACAGGTAAGTGTCACCACCTGG - Intronic
1025139989 7:56454815-56454837 TACAGGTGCCTGCCACCACCAGG + Intergenic
1025239693 7:57260821-57260843 TACAGGTGCCCACCACCACCAGG + Intergenic
1025997520 7:66537386-66537408 TACAGGTGTGTGCCACTACCTGG - Intergenic
1026025074 7:66738159-66738181 TACAGGTACAGGCCACCACCTGG + Intronic
1026066359 7:67076913-67076935 TACAGGCTCGTGCCACCACCTGG + Intronic
1026400102 7:70001399-70001421 TACAGGTGCGAGACACCACACGG + Intronic
1026676150 7:72430094-72430116 TACAGGTGTGAGCCACCGCCCGG + Intronic
1026838370 7:73653287-73653309 TACAGGTGTGTACCACCACCCGG + Intergenic
1027361761 7:77416496-77416518 CTCAGGTGCGGGCCGCCGGCCGG - Intergenic
1027513083 7:79108159-79108181 CAAAGATGAGGGCCAGCACCTGG - Intronic
1028816479 7:95152090-95152112 TACAGGTGCGTGCCACCACGTGG + Intronic
1029479560 7:100804274-100804296 TACAGGCGTGAGCCACCACCTGG + Intronic
1029524654 7:101087564-101087586 CACAGGCCCGGGCCTTCACCAGG - Exonic
1029661703 7:101966691-101966713 GACAGGTGAGGGCCACCTGCAGG + Intronic
1029713389 7:102312232-102312254 TACAGGTGCATGCCACCACCAGG - Intronic
1031489392 7:122368792-122368814 AACAGATGCAGGCCACCAGCAGG + Intronic
1032092248 7:128916701-128916723 TACAGGCGCAAGCCACCACCTGG - Intergenic
1032196286 7:129790682-129790704 TACAGGAGCCCGCCACCACCTGG + Intergenic
1033200397 7:139363179-139363201 CACAGGCGGTTGCCACCACCAGG - Intronic
1033358570 7:140621308-140621330 TACAGATGTGAGCCACCACCAGG + Intronic
1033774493 7:144592456-144592478 TACAGGTGCGCACCACCACGTGG - Intronic
1033910198 7:146253919-146253941 TACAGGTGCATGCCACCACATGG - Intronic
1034260540 7:149752728-149752750 CACAGATGGGGGCCACCTCCTGG - Intergenic
1034631716 7:152536174-152536196 TACAGGCGTGAGCCACCACCCGG - Intergenic
1034659571 7:152757795-152757817 CCCAGGAGCGGGGAACCACCAGG + Intergenic
1035522319 8:284700-284722 CACAGGTCCCAGCCAGCACCGGG - Intergenic
1035667138 8:1387772-1387794 CACAGGTGAGGCCCTCCACCTGG - Intergenic
1035860656 8:3024444-3024466 CACAGGTACATGCCACCACACGG + Intronic
1039016657 8:33156989-33157011 CACAGGCATGTGCCACCACCTGG - Intergenic
1039042910 8:33425058-33425080 TACAGGTGTGAGCCAGCACCCGG - Intronic
1039304918 8:36251014-36251036 CTCAGGTGCTGGCCGCCAGCTGG - Intergenic
1039446411 8:37636710-37636732 CACAGGTGTGTGCCACCACGTGG - Intergenic
1039795039 8:40905744-40905766 TATAGGTGCAGGCCACCACATGG + Intergenic
1042499330 8:69491674-69491696 CATAGGTGAGAGCCACCACATGG - Intronic
1045461523 8:102429732-102429754 CACAGGTGTGAGCCAACACCCGG + Intergenic
1047464067 8:125095451-125095473 CACAGGCGCGCGCCACCACTTGG - Intronic
1049058836 8:140259820-140259842 CACAGGGCCTGGCCACCAGCAGG + Intronic
1049501840 8:142971308-142971330 GACAGGTGAGGGGCAGCACCTGG + Intergenic
1049970253 9:815821-815843 CACAAGTGTGTTCCACCACCTGG + Intergenic
1050617851 9:7421204-7421226 TACAGGTGTGTGCTACCACCTGG + Intergenic
1050886397 9:10771892-10771914 TACAGGTGCACACCACCACCTGG + Intergenic
1051103157 9:13546129-13546151 TACAGGTGTGAGCCACCACCCGG - Intergenic
1051534482 9:18141579-18141601 AAGAAGTGCTGGCCACCACCAGG - Intergenic
1052152022 9:25128865-25128887 TACAGGTGTGAGCCACCGCCCGG + Intergenic
1052805996 9:33013885-33013907 GACAGGTGGGGGCAACCACCAGG + Intronic
1053215499 9:36266923-36266945 TACAGGCGGGGGCCACCACCCGG - Intronic
1053258163 9:36636973-36636995 TACAGGTGCCTGCCACCACCCGG + Intronic
1054780295 9:69159733-69159755 TACAGGCGCGTTCCACCACCTGG - Intronic
1056247144 9:84706668-84706690 TACAGGTGCCCGCCACCGCCTGG + Intronic
1056290025 9:85133926-85133948 TACAGGTGTGAGCCACTACCTGG - Intergenic
1057018569 9:91677846-91677868 CACAGGTGCTGGGCAACACCTGG + Intronic
1057018745 9:91679213-91679235 CACAGGTGCTGGGCAACACCTGG - Intronic
1057360839 9:94372752-94372774 TACAGGTGCATGCCACGACCTGG - Intergenic
1057662500 9:97015390-97015412 TACAGGTGCATGCCACGACCTGG + Intergenic
1058587865 9:106530007-106530029 TACAGGTGTGTGCCACCACCAGG - Intergenic
1059244527 9:112838163-112838185 TACAGGTATGAGCCACCACCAGG + Intronic
1059818601 9:117946803-117946825 CACAGGTGGGGGCCAGCCCAAGG + Intergenic
1060110545 9:120903667-120903689 GATAGGTGTGGGCCACCACCAGG + Exonic
1060175249 9:121492866-121492888 TACAGGTACAAGCCACCACCCGG - Intergenic
1060183105 9:121547318-121547340 TACAGGTGAGTGCCACCACCCGG + Intergenic
1060379472 9:123153464-123153486 TACAGGTGTGAGCTACCACCCGG + Intronic
1060516257 9:124267651-124267673 CTCAGGGGCGGCCCAGCACCTGG - Intronic
1060597590 9:124857507-124857529 CACAGGTGTGGGCCACATCCAGG - Exonic
1060656447 9:125375560-125375582 TACAGGTGTGAACCACCACCCGG - Intergenic
1061328412 9:129877929-129877951 TACAGGTGTGTGCCACCACCTGG - Intronic
1062436680 9:136549434-136549456 CCTGGGTGGGGGCCACCACCAGG + Intergenic
1062461599 9:136664713-136664735 CACAGGTGGCCCCCACCACCCGG + Exonic
1203546270 Un_KI270743v1:130653-130675 CACAGGTGCAGACCAGCCCCAGG - Intergenic
1186494002 X:9997392-9997414 CACAGCTGCAGGCGAGCACCTGG + Intergenic
1187448375 X:19376584-19376606 CACAGGTGTGCACCACCACATGG + Intronic
1187612620 X:20959099-20959121 TACAGGCGCAAGCCACCACCCGG - Intergenic
1188104626 X:26134978-26135000 TACAGGTGCGTGCCACCACATGG + Intergenic
1188400537 X:29738713-29738735 TACAAGTGTGAGCCACCACCTGG + Intronic
1188400635 X:29739781-29739803 TACACGTGCGAGCCACCACGCGG - Intronic
1189430482 X:40942460-40942482 CACAGGTATGTGCCACCACACGG + Intergenic
1190026407 X:46927670-46927692 TACAGGTGGGAGCCACCACCTGG + Intronic
1190048872 X:47134299-47134321 CACAGGTGTGCGCTACCACCTGG + Intergenic
1190356038 X:49605766-49605788 CACAGGCGCGTGCCACCACAAGG - Intronic
1192212445 X:69136635-69136657 CAGAGTTGGGGGCCAACACCTGG + Intergenic
1192838282 X:74825826-74825848 TACAGGTGTGAGCCACCACCCGG + Intronic
1196741312 X:119028518-119028540 AACAGGTGCCGGCGCCCACCTGG + Intergenic
1196843257 X:119878189-119878211 TACAGGTGTGAGCCACCGCCCGG - Intergenic
1198648647 X:138837385-138837407 CCCAGGTGCGAGGCTCCACCTGG + Intronic
1198845034 X:140901341-140901363 TACAGGTGTGAGCCACCGCCTGG - Intergenic
1200074019 X:153542444-153542466 CTCAGGTGAGGGCCACCCTCCGG + Exonic