ID: 1119372751

View in Genome Browser
Species Human (GRCh38)
Location 14:74161679-74161701
Sequence TGGCCACGGGAACACTCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 100}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119372748_1119372751 -4 Left 1119372748 14:74161660-74161682 CCTCTGAAGGGAAAACACATGGC 0: 1
1: 0
2: 0
3: 18
4: 172
Right 1119372751 14:74161679-74161701 TGGCCACGGGAACACTCTGCCGG 0: 1
1: 0
2: 1
3: 11
4: 100
1119372743_1119372751 16 Left 1119372743 14:74161640-74161662 CCACAAGGCTGAGGTTCAGCCCT 0: 1
1: 0
2: 5
3: 31
4: 233
Right 1119372751 14:74161679-74161701 TGGCCACGGGAACACTCTGCCGG 0: 1
1: 0
2: 1
3: 11
4: 100
1119372746_1119372751 -3 Left 1119372746 14:74161659-74161681 CCCTCTGAAGGGAAAACACATGG 0: 1
1: 0
2: 1
3: 19
4: 199
Right 1119372751 14:74161679-74161701 TGGCCACGGGAACACTCTGCCGG 0: 1
1: 0
2: 1
3: 11
4: 100
1119372742_1119372751 17 Left 1119372742 14:74161639-74161661 CCCACAAGGCTGAGGTTCAGCCC 0: 1
1: 0
2: 1
3: 20
4: 127
Right 1119372751 14:74161679-74161701 TGGCCACGGGAACACTCTGCCGG 0: 1
1: 0
2: 1
3: 11
4: 100
1119372741_1119372751 18 Left 1119372741 14:74161638-74161660 CCCCACAAGGCTGAGGTTCAGCC 0: 1
1: 0
2: 3
3: 14
4: 166
Right 1119372751 14:74161679-74161701 TGGCCACGGGAACACTCTGCCGG 0: 1
1: 0
2: 1
3: 11
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119372751 Original CRISPR TGGCCACGGGAACACTCTGC CGG Intronic
900321895 1:2088598-2088620 TGTCTACGGGAAGACTCTGCTGG - Intronic
900688710 1:3966275-3966297 TGGCCCCTGCACCACTCTGCAGG + Intergenic
903380376 1:22892613-22892635 TGGCCACTGGAACATTCTAGTGG - Intronic
903462941 1:23531620-23531642 TGGCCTGGGGAATACACTGCTGG - Intergenic
903563319 1:24245591-24245613 GGGACACTGGAACACTCTGGAGG + Intergenic
917906209 1:179589002-179589024 TGCCCATGGGAACACAGTGCTGG + Intergenic
922299611 1:224286031-224286053 TGGCTGTGGGAAGACTCTGCTGG - Exonic
1064316532 10:14263013-14263035 TGGCCAGGGGAACACTGACCTGG - Intronic
1069071964 10:63998516-63998538 TGGCCATGGGAACCCCCTGCTGG - Intergenic
1071000846 10:80828692-80828714 GGGCCACTGGAACAATCTTCCGG + Intergenic
1075976561 10:126701254-126701276 TGGCCACTGGAACACCCAGTAGG - Intergenic
1076715268 10:132360852-132360874 AGTCCCCGGGAACACACTGCAGG + Intronic
1077222490 11:1423834-1423856 GGGCACCGGGAACACTCAGCGGG - Intronic
1077374043 11:2197372-2197394 TGGCCACCTGGACACCCTGCAGG - Intergenic
1077408334 11:2392437-2392459 TGGCCACGGTGACACCATGCAGG - Intronic
1077433636 11:2527993-2528015 TGGCCACGGGGACTCTCTTCTGG + Exonic
1080298243 11:30754523-30754545 GTGCCAGGGGAACACACTGCTGG - Intergenic
1081238040 11:40669790-40669812 TGTCCAATGTAACACTCTGCTGG + Intronic
1086914298 11:92511041-92511063 TGCCCACAGGTACACACTGCAGG - Intronic
1087836028 11:102875999-102876021 TGGCCTGGGAAACAGTCTGCTGG + Intergenic
1089110972 11:116055761-116055783 GGGCCACGGGACCACTGTGGAGG + Intergenic
1098689162 12:73465296-73465318 TGGCTACAGGGACTCTCTGCAGG - Intergenic
1104966537 12:132511024-132511046 TCGCCACTGGGCCACTCTGCAGG - Intronic
1113665379 13:112137345-112137367 TGGCCCCGGGATCTCTCTGGTGG + Intergenic
1119197985 14:72731761-72731783 TGGTGACAGGAACACTCTGTGGG + Intronic
1119372751 14:74161679-74161701 TGGCCACGGGAACACTCTGCCGG + Intronic
1128063110 15:64747646-64747668 AGGTCACTGGAGCACTCTGCAGG - Intronic
1129207243 15:74044501-74044523 TGGCCCCGGGCACACGCTCCCGG - Exonic
1129367081 15:75062769-75062791 TGGCCACTGGTCCACTCTGGAGG - Intronic
1129663784 15:77567932-77567954 TGACCACGGGCACTCTCTGCAGG + Intergenic
1129917154 15:79283714-79283736 TGGACGCTGGCACACTCTGCCGG + Intergenic
1132470692 16:101292-101314 TCACCACTGGAACACTCTGGGGG - Intronic
1132801604 16:1757497-1757519 TGGCGAGGGAAACGCTCTGCGGG - Intronic
1134796427 16:17041217-17041239 TGGCCATGGGAACAAACTGAAGG - Intergenic
1147949116 17:44097216-44097238 TGGCCTCTGGAACCCCCTGCAGG + Intronic
1148663874 17:49360947-49360969 TGAACACGGGAACAATCTGGGGG + Intronic
1154358499 18:13640762-13640784 TGGCCTCAGGAACTCTCTGTGGG + Intronic
1157139860 18:45094897-45094919 TGGCAAAAGGAACTCTCTGCAGG - Intergenic
1157520785 18:48343841-48343863 AGGCCAGTGGAACAATCTGCAGG - Intronic
1160513091 18:79463434-79463456 TGGACACGGGAACAGGCTGCGGG - Intronic
1160572745 18:79830112-79830134 TGGCCACGAGTAGATTCTGCAGG + Intergenic
1162583195 19:11542963-11542985 TGGCCTCGGGAAGACTTTGAAGG + Intronic
1162935735 19:13980578-13980600 GGGTGACGGGGACACTCTGCTGG + Exonic
1166255653 19:41602264-41602286 AGGCCCAGGGAACACTCTGTTGG + Intronic
933740121 2:85526710-85526732 TGCCCAAGGGAACACTCAGAAGG - Intergenic
938181933 2:129191768-129191790 TGGCCACGTGTTCCCTCTGCTGG + Intergenic
942067021 2:172281101-172281123 TGGCCACGTGAACACACTGCTGG + Intergenic
948159088 2:235809459-235809481 TGGCCACGGGGGCACTTTGCTGG - Intronic
1168795364 20:607493-607515 TGGCCCCTTGAAGACTCTGCTGG - Intronic
1170588646 20:17754439-17754461 TGGACACAGACACACTCTGCAGG - Intergenic
1170644590 20:18186170-18186192 TGGCCTCGCAAACACTCAGCAGG - Intronic
1173087883 20:39941990-39942012 TTGCCACTGGAAAACTCTGTAGG + Intergenic
1179292596 21:40031753-40031775 TGGCCTCCTGTACACTCTGCTGG + Intronic
1181052131 22:20242970-20242992 TGCCCACGGGCACAGCCTGCAGG + Exonic
1181112035 22:20607869-20607891 TGGCCAAGGGCACAGTCTGGCGG - Intergenic
950047719 3:9960051-9960073 AGGCCATGGGAACATCCTGCAGG - Intergenic
952082251 3:29773623-29773645 TGGCCACGGGCAAACACTCCGGG - Intronic
955320392 3:57970184-57970206 TGGCCCCAGGAACACACTGTAGG + Intergenic
959599301 3:108161565-108161587 TGGCCAGGGGAACACAAAGCAGG - Exonic
963226935 3:142872050-142872072 TGGCCACGGGAAGCCCCTACAGG + Intronic
969284990 4:6197593-6197615 TGGCGACGGGATCAACCTGCAGG - Intronic
969461710 4:7332525-7332547 TGGCCTAGGCAACACTCTCCGGG + Intronic
976604263 4:86968057-86968079 TGGCCAAGAGAGCACTCTCCTGG - Intronic
979758653 4:124373519-124373541 TGGCAACTGGAACACTCAGTTGG + Intergenic
981874192 4:149520937-149520959 TGTGCACAGCAACACTCTGCTGG + Intergenic
985706963 5:1406922-1406944 TGGCCTCAGGGACACTCTACAGG - Intronic
985813671 5:2110819-2110841 TGGCCACTGGCTCACTCTCCTGG - Intergenic
988593884 5:32573450-32573472 TGGCTACGAGAGCACTGTGCTGG + Intronic
988806969 5:34749488-34749510 TGGCCAAGGGCAGACACTGCCGG + Intronic
989170783 5:38469008-38469030 GGCCCAGGGGAACACGCTGCTGG - Intergenic
989896492 5:47093488-47093510 TGGACATTGGAACACTCTGATGG - Intergenic
991186338 5:63812878-63812900 TGGCCATGAGAACAATATGCAGG - Intergenic
991481499 5:67085921-67085943 TGGGCACTGGAACACGATGCAGG - Intronic
994023182 5:95051468-95051490 CTACCAGGGGAACACTCTGCTGG + Intronic
999702686 5:154242561-154242583 TGGCCACTGGGACCCTCTCCAGG - Intronic
1002102078 5:176862628-176862650 TGGCCACGGTGGCACTCTGCTGG - Exonic
1002207800 5:177575902-177575924 TGGGCCCGGGAACATCCTGCAGG - Intergenic
1002431849 5:179208496-179208518 TGGCCAGGGGCACACCCTGGGGG - Intronic
1202772170 5_GL000208v1_random:16846-16868 TGGACATTGGAACACTCTGATGG - Intergenic
1004134367 6:12952191-12952213 TAACCAAGGGATCACTCTGCTGG - Intronic
1007193258 6:40037929-40037951 TTGCCAAGGGTACACTCAGCTGG - Intergenic
1007943506 6:45804248-45804270 TGGCCACGGCTACACTCTGGTGG + Intergenic
1017289897 6:152723722-152723744 TGCCCACTGGAACTCTCTGGTGG - Exonic
1018807271 6:167271040-167271062 CAGCCAGGGGAACACACTGCGGG - Intergenic
1018847865 6:167567564-167567586 GAGCCACGGGAACACTCTGGTGG + Intergenic
1019630411 7:2046037-2046059 TGGCCACTGCAGCACTCAGCTGG - Intronic
1021271029 7:18585586-18585608 TGCCCATGGGAACACTTTGCGGG + Intronic
1022334880 7:29412742-29412764 TGGCCACGAGAGCCCTCTGTTGG + Intronic
1023396707 7:39758311-39758333 TGGACAAGGGACCACTCTGGAGG + Intergenic
1023527534 7:41120354-41120376 TGGCAAAGGGAACAGTCAGCAGG - Intergenic
1023835435 7:44064853-44064875 AGCCCACGGGAACAGCCTGCGGG - Exonic
1024231515 7:47367301-47367323 CGGCCAGGGAAACACTCAGCAGG - Intronic
1024706282 7:51964042-51964064 TGACCACAGGAACATTCTCCTGG - Intergenic
1026053278 7:66964580-66964602 TGTTCAAGGGAACATTCTGCTGG + Intergenic
1026406548 7:70071998-70072020 GGCCCAAGGGAAAACTCTGCAGG + Intronic
1028813876 7:95121717-95121739 TTGCCACGGGATGACTCAGCTGG - Intronic
1032326398 7:130932958-130932980 TAGCCACTGTAACACACTGCAGG + Intergenic
1033264809 7:139875830-139875852 TGCCCACGGGGGGACTCTGCTGG + Intronic
1034276573 7:149826443-149826465 TGGCCAGGGGGGCACTCTGTGGG - Intergenic
1037329240 8:17727359-17727381 TGGCCGAGGGAACACTGGGCAGG - Intronic
1037574156 8:20184988-20185010 TGGACACAGGTACACTATGCCGG - Intergenic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1041367560 8:57124734-57124756 TTGCCACAGGAACTCTCTGGAGG - Intergenic
1042750607 8:72153824-72153846 TTGCCAAGGCCACACTCTGCAGG - Intergenic
1044190979 8:89317048-89317070 TGGCCATGCGAACTCTCTGCTGG + Intergenic
1049071290 8:140357812-140357834 TGGCCACCTGCTCACTCTGCAGG + Intronic
1049505156 8:142992264-142992286 TGGCCTTGGGAAGACCCTGCAGG - Intergenic
1056169146 9:83966001-83966023 TGGTCATAGGAACACTTTGCAGG + Intergenic
1057282116 9:93720512-93720534 TGGCAGCGGGAAGACTGTGCAGG + Intergenic
1061729953 9:132605928-132605950 TGGCCACAGGAAGACTCGGTGGG + Intronic
1195678648 X:107526745-107526767 GGGCTAGGGGAACACTCTGAGGG - Intronic
1199380344 X:147165158-147165180 GGGCCACGGGGACAGTCTTCTGG - Intergenic
1200115593 X:153768450-153768472 TGGCCAGGGGCACACCCAGCCGG - Intronic