ID: 1119373804

View in Genome Browser
Species Human (GRCh38)
Location 14:74171548-74171570
Sequence CTAGTTCATAACATTTATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 307}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119373804 Original CRISPR CTAGTTCATAACATTTATTT AGG (reversed) Intronic
903615383 1:24650358-24650380 TTAGTTCATAACAGTTAATTTGG + Intronic
905158432 1:36009120-36009142 CTCATACAGAACATTTATTTTGG + Intronic
905501465 1:38442671-38442693 CAAATTTCTAACATTTATTTTGG - Intergenic
905630543 1:39515714-39515736 CACGTTCCTAACATTTATGTAGG + Intronic
906366006 1:45210325-45210347 TTATTTAATAAAATTTATTTTGG + Intronic
907211471 1:52827313-52827335 AAAATTTATAACATTTATTTAGG - Exonic
907990866 1:59581305-59581327 CTAGTTGAGAACATTTCTATTGG + Intronic
908702917 1:66921545-66921567 CAATTTCATAACATCTATTAAGG - Intronic
909263396 1:73524780-73524802 ATGTTTCATAACATTAATTTAGG + Intergenic
909406218 1:75292377-75292399 CTAGTAAATAACACTTTTTTGGG + Intronic
909821512 1:80068359-80068381 CTAATTTTTAATATTTATTTTGG + Intergenic
910461133 1:87449036-87449058 GTAAATCATGACATTTATTTTGG + Intergenic
910822385 1:91365304-91365326 ATAGTTAATAAAAATTATTTTGG + Intronic
911910959 1:103634756-103634778 CTGGTTCTTATAATTTATTTGGG - Intergenic
911918374 1:103728881-103728903 CTGGTTCTTATAATTTATTTGGG - Intronic
912898258 1:113617781-113617803 CTACTTTAAAAAATTTATTTAGG - Intronic
914318373 1:146535371-146535393 GTAAATCATGACATTTATTTGGG + Intergenic
914495987 1:148197986-148198008 GTAAATCATGACATTTATTTGGG - Intergenic
914998142 1:152562583-152562605 CTTGTTCAGAGCATTCATTTTGG + Intronic
916914120 1:169387305-169387327 CTAGTACATAAAATATCTTTGGG - Exonic
917751958 1:178061574-178061596 CTATTTGAGGACATTTATTTGGG + Intergenic
918072992 1:181147420-181147442 GTAGTTAATCTCATTTATTTGGG - Intergenic
918175819 1:182044306-182044328 TTATTTGCTAACATTTATTTAGG + Intergenic
918750925 1:188268373-188268395 CCAGTGCATTACATTTATTGTGG + Intergenic
919014322 1:192011237-192011259 CTTTTTCACAACCTTTATTTAGG - Intergenic
919235265 1:194832664-194832686 ACAGTTTATTACATTTATTTTGG - Intergenic
920737526 1:208546681-208546703 GTAGTTCATGAGATTTAGTTAGG + Intergenic
921549006 1:216510444-216510466 CTAGTTCAGATCATTTACTTTGG + Intronic
921668793 1:217903761-217903783 CTAATTCATATCATTTCTCTTGG - Intergenic
921717608 1:218434411-218434433 CTAGTTCTTCACTTTTATTTGGG - Exonic
921807985 1:219477987-219478009 CTAGTTTAAAACTTTTATTAGGG - Intergenic
922532987 1:226358492-226358514 CTAGGTTATAAGATATATTTTGG - Intergenic
923212695 1:231819179-231819201 TTAGTAAATGACATTTATTTAGG - Exonic
923373412 1:233335415-233335437 TGAGTTTTTAACATTTATTTAGG + Intronic
924389986 1:243544036-243544058 TTAGTCAACAACATTTATTTGGG - Intronic
1063333815 10:5189503-5189525 CTAGTTCAGAACATAGAGTTGGG + Intergenic
1065484094 10:26220037-26220059 TTCATTTATAACATTTATTTGGG + Intronic
1069023066 10:63511083-63511105 CTAGTTGATAACATATAGTTGGG + Intergenic
1074424006 10:113335148-113335170 CTAATTCAAAACATTTAATGTGG + Intergenic
1074599439 10:114898910-114898932 ATTGGTCATAACATTTGTTTTGG + Intronic
1074803212 10:117023315-117023337 CTAGATTCTAAAATTTATTTGGG - Intronic
1075233833 10:120709094-120709116 ATAGTTCAAGAGATTTATTTGGG - Intergenic
1075924467 10:126239580-126239602 CAAGCACATGACATTTATTTAGG + Intronic
1077807962 11:5608541-5608563 CCAGTTCATCCCCTTTATTTGGG - Intronic
1078435564 11:11322070-11322092 CTAATAGATAACATTTATTGAGG + Intronic
1078942164 11:16019545-16019567 TTAGTTCATAACACAGATTTAGG - Intronic
1080131358 11:28798807-28798829 CGAGATCTGAACATTTATTTAGG + Intergenic
1080300583 11:30780583-30780605 CAAGTTTATAACATATAATTAGG + Intergenic
1080377381 11:31729093-31729115 CTAGTTTAAAACCTTTCTTTTGG - Intronic
1083077419 11:60055473-60055495 CTATTTTAGGACATTTATTTAGG + Intergenic
1084140059 11:67221510-67221532 CTATTTTGCAACATTTATTTTGG + Intronic
1085924597 11:81000992-81001014 TTACTACCTAACATTTATTTAGG + Intergenic
1086127683 11:83365974-83365996 CTTGTTCTTCAGATTTATTTTGG + Intergenic
1087040796 11:93797781-93797803 TTATTTCATAACACTTTTTTGGG + Intronic
1091516875 12:1193337-1193359 CTACTTCTTAAGATTTAATTGGG - Intronic
1092826060 12:12399981-12400003 TTATTTAATAACATTTAATTTGG - Intronic
1093793113 12:23278252-23278274 CAAGCTCATTACATTTATTGTGG + Intergenic
1094140222 12:27173079-27173101 CTAATTCAAAACATTTTCTTTGG - Intergenic
1094749433 12:33388552-33388574 GTATTCCATAAAATTTATTTTGG + Intronic
1095135545 12:38597418-38597440 CTCTTTCTTAACATTTCTTTGGG - Intergenic
1095787330 12:46123994-46124016 CTACTTCATAACATTGGTTACGG + Intergenic
1096411720 12:51381791-51381813 ATAGTTGATACCATTTATTGAGG - Intronic
1096821214 12:54236452-54236474 CTAATTCAGAACATGTTTTTGGG + Exonic
1099410443 12:82320083-82320105 CTTGTTAATAACATTTACTGAGG - Intronic
1099655822 12:85489254-85489276 CTGGTTGATAACATTTGTTAAGG + Intergenic
1100710639 12:97252603-97252625 CTACTTTAGAAAATTTATTTAGG + Intergenic
1101460580 12:104888483-104888505 CTACTTTAGAACTTTTATTTGGG - Intronic
1101468346 12:104971094-104971116 ATAGTGCAAATCATTTATTTTGG - Intergenic
1105901992 13:24763551-24763573 CCGGTACATAACACTTATTTTGG + Intergenic
1106062716 13:26310420-26310442 CTAGTGCATTACATTTATTGTGG + Intronic
1107500130 13:40965091-40965113 CTAGTTTATACAAGTTATTTCGG - Intronic
1107956923 13:45523655-45523677 CAATTTCATAACATAGATTTAGG - Intronic
1108750610 13:53444632-53444654 CTATGTCATCACCTTTATTTCGG - Intergenic
1109801540 13:67385001-67385023 CTAGTTCATTACATTTAAGATGG + Intergenic
1110899150 13:80798748-80798770 TTAGGACATAATATTTATTTTGG + Intergenic
1111896448 13:94148176-94148198 CTGGTTCATAAAATTTAATTTGG - Intronic
1113391043 13:109897513-109897535 TCAGTGCCTAACATTTATTTGGG + Intergenic
1114253749 14:20984134-20984156 CTTGTTCCTACCATTGATTTGGG + Intergenic
1114738139 14:25064101-25064123 TTATTTCAGAACATTTGTTTTGG - Intergenic
1115019325 14:28656207-28656229 CTCATTGATAAAATTTATTTAGG - Intergenic
1116078196 14:40140165-40140187 TTGGTACATAACATTTATATTGG - Intergenic
1117086023 14:52202135-52202157 CTAGTCAATATAATTTATTTAGG - Intergenic
1118048515 14:62000457-62000479 CTAGTACATAGCATATAATTGGG + Intronic
1118065497 14:62186059-62186081 CTAGTTCACAAAGTTTATCTAGG - Intergenic
1119373804 14:74171548-74171570 CTAGTTCATAACATTTATTTAGG - Intronic
1119831029 14:77702852-77702874 CTAATTAAAAACATTTTTTTTGG + Intronic
1120318127 14:82922587-82922609 CTATTTCTTAATATTTACTTAGG - Intergenic
1120320252 14:82950592-82950614 ATAGTTCATAAAGTTTATATTGG + Intergenic
1122504662 14:102224559-102224581 CTAATTCATCACATTAAATTGGG + Intronic
1126712628 15:51477137-51477159 TTAGTTCATAACTTTAATTTAGG - Intronic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1128905196 15:71461338-71461360 CTAGGTCATAAAATATATTGGGG - Intronic
1129481861 15:75832876-75832898 CTAGTGCAAATAATTTATTTTGG - Intergenic
1130058440 15:80550894-80550916 CTTGGACAAAACATTTATTTAGG - Intronic
1130383343 15:83390931-83390953 CTCCTTTAGAACATTTATTTGGG - Intergenic
1131320012 15:91379332-91379354 CTATTCCAGAACAATTATTTTGG - Intergenic
1131880465 15:96857103-96857125 CCAGTTCCTAACATATATTAGGG - Intergenic
1131964457 15:97826616-97826638 CTAGTGTCTAACATTAATTTGGG + Intergenic
1135834863 16:25815915-25815937 CTTTTTTATAACAATTATTTTGG + Intronic
1136691121 16:32030413-32030435 TTTGTTTATAACATTTATGTTGG - Intergenic
1136878107 16:33879956-33879978 TTTGTTTATAACATTTATGTTGG + Intergenic
1137843627 16:51665282-51665304 CTGGTTCACATTATTTATTTTGG + Intergenic
1138363449 16:56452132-56452154 ATAGTTCATAATATTTACCTCGG + Intronic
1138465982 16:57190491-57190513 CTATTTCAAAAGAATTATTTGGG + Intronic
1139016183 16:62691775-62691797 CTGGTTCATTCCATTTCTTTGGG - Intergenic
1139102123 16:63780859-63780881 TTTGTTCCTAACATTTGTTTTGG - Intergenic
1139799347 16:69508917-69508939 CTATTTAAAAACATTTTTTTTGG + Intergenic
1141315476 16:82958668-82958690 TAAGTTCAAAACATTCATTTAGG + Intronic
1203093919 16_KI270728v1_random:1235435-1235457 TTTGTTTATAACATTTATGTTGG - Intergenic
1145304110 17:21662677-21662699 CTAATTAATAACTTTTATATTGG + Intergenic
1148832365 17:50442002-50442024 CTAATTAAAAACATTTTTTTTGG + Intronic
1149119546 17:53145773-53145795 ATAGTGCCTAACATTTACTTAGG + Intergenic
1150557028 17:66263558-66263580 CCAGTTGAAAACAGTTATTTTGG + Intergenic
1150819482 17:68423745-68423767 CTTGTGCAGATCATTTATTTGGG - Intronic
1150963985 17:69946941-69946963 CTATTTTATAACATCTATCTAGG + Intergenic
1153084358 18:1266937-1266959 CTTTTTAATAACATTTCTTTTGG - Intergenic
1153340159 18:3965367-3965389 GTTGTTCTTAAGATTTATTTTGG - Intronic
1153813007 18:8768288-8768310 CTAGTTAACAACATGTATTTTGG - Intronic
1154065796 18:11105997-11106019 CAAATTCTTAAAATTTATTTTGG + Intronic
1156178275 18:34573291-34573313 TTTGTTCCTAATATTTATTTAGG - Intronic
1156571233 18:38255718-38255740 TTAATTCAGAACCTTTATTTAGG + Intergenic
1156947180 18:42848547-42848569 CTACTTCATAACATTTTTTATGG - Intronic
1158190849 18:54827197-54827219 CCAGTTCCTAAAAATTATTTTGG - Intronic
1158779360 18:60628234-60628256 CTCTTTCATAACATTTATCATGG + Intergenic
1159589857 18:70322185-70322207 CTAATTCAGAACATTTACTTAGG + Intronic
1162212473 19:9103445-9103467 ACAGTTCAAAACATTTACTTAGG + Intergenic
1163322858 19:16584856-16584878 CTATTTCCTAGCATTTGTTTGGG + Intronic
1163949839 19:20573069-20573091 CTGGTTCTGAACATTTTTTTTGG + Intronic
1163987690 19:20968730-20968752 CTAGGTCATTTCACTTATTTTGG + Intergenic
1164102597 19:22070783-22070805 CTTGTTTAAAACATTCATTTTGG + Intronic
1166324355 19:42040127-42040149 CAAGTGCTTAACATTTCTTTAGG - Intronic
1167803382 19:51761445-51761467 CTCGTTAATAACTTTCATTTTGG + Intronic
926472777 2:13281905-13281927 CTGCTTCATAAGATGTATTTAGG - Intergenic
926999643 2:18780542-18780564 CAAGTTCAGAAAGTTTATTTGGG - Intergenic
927588999 2:24336325-24336347 CAAGCCAATAACATTTATTTAGG - Intronic
928817525 2:35317430-35317452 CTTTTTCATAACATATATTCAGG - Intergenic
929101632 2:38320491-38320513 CTAGTTAAAAACTTTTATTATGG - Intronic
929678799 2:43967236-43967258 CTAGTTCAAATAATTTTTTTTGG - Intronic
931713826 2:65012387-65012409 CTAGTTCTTAACAATTAAGTAGG - Intronic
933316705 2:80724047-80724069 CTAGTTGATCACATTTCTTCTGG + Intergenic
936772282 2:115928406-115928428 TTAGTTGATTACATTTATATGGG + Intergenic
936917850 2:117658502-117658524 CTTGGTCAAAACATTTTTTTTGG + Intergenic
939584967 2:143993116-143993138 CTCCTTCATAACATTTATCACGG + Intronic
940349577 2:152667092-152667114 CTATTTCAAAAGATTTATTTAGG - Intronic
941115133 2:161462989-161463011 ATGGTTCATAGCATTTATTGAGG + Intronic
942165666 2:173238257-173238279 CTAGTTCATAAAATATCTTGGGG - Intronic
942871027 2:180734221-180734243 TAAGTTCATAACATTTATTACGG - Intergenic
943276817 2:185877471-185877493 TTATTTCAGAACTTTTATTTTGG - Intergenic
943661636 2:190565482-190565504 AGAGTTCAGAACATTTATTAGGG + Intergenic
943713112 2:191120105-191120127 TTAGATCATAACATTCTTTTAGG - Intronic
943971878 2:194420235-194420257 CTTTTTCATAAAAGTTATTTTGG + Intergenic
943974743 2:194459361-194459383 CTAGTTCATATTGTTCATTTTGG - Intergenic
944296547 2:198069486-198069508 CTAGTGCATATTTTTTATTTTGG - Intronic
946465264 2:219906071-219906093 CTACTTCATAATCTTTATTTGGG + Intergenic
947416477 2:229901665-229901687 CTACTTCAGAACAGTTTTTTAGG + Intronic
947550317 2:231040799-231040821 CTTGTTCATAATCTTTATTCAGG - Intronic
1168861251 20:1047557-1047579 CCAGTTCATCACATGTCTTTTGG - Intergenic
1169490368 20:6066149-6066171 CTTGTTCACCACATTTCTTTAGG + Intergenic
1169602592 20:7278607-7278629 AGAGTTCATCACATTAATTTGGG + Intergenic
1169707071 20:8517743-8517765 CTAGTTCAGAACATACATTCAGG + Intronic
1170220699 20:13938593-13938615 ATAATCTATAACATTTATTTTGG - Intronic
1170294456 20:14808616-14808638 CTAGTTTATATCTTTTAATTGGG - Intronic
1171510720 20:25682167-25682189 TTAGTTCCTAAGATTTTTTTTGG - Intronic
1171521667 20:25780495-25780517 CTAATTAATAACTTTTATATTGG + Intronic
1171555174 20:26075556-26075578 CTAATTAATAACTTTTATATTGG - Intergenic
1173340431 20:42148281-42148303 TTAGTTCAAAAGATGTATTTGGG + Intronic
1176655468 21:9585419-9585441 CTAATTAATAACTTTTATATTGG + Intergenic
1176704315 21:10100410-10100432 GTAGTTCTTTACATTTATTTAGG + Intergenic
1176912584 21:14584856-14584878 TTACTTCCAAACATTTATTTGGG - Intergenic
1177521278 21:22229987-22230009 TTAGTTCAAAGCATTTATTAGGG - Intergenic
1177723859 21:24942392-24942414 CTATTTCATTACAATTATTTGGG - Intergenic
1182193855 22:28493590-28493612 CTAGATCCTAAAATTAATTTGGG - Intronic
1182412013 22:30195264-30195286 CTAGCTCATAACTATTTTTTTGG - Intergenic
1182865302 22:33599161-33599183 CTATCTCATACCATTTCTTTTGG + Intronic
1183756860 22:39775515-39775537 CTAGTAAATAACATTGATTTGGG - Intronic
1183918092 22:41139597-41139619 CTAGTGCAAAACATTTTGTTAGG + Intronic
949113434 3:291064-291086 ATAGTTCAAAACATTAATATAGG + Intronic
949575418 3:5334153-5334175 CTATTTGAAAACAGTTATTTTGG - Intergenic
949575550 3:5335520-5335542 CTATTTGAAAACAGTTATTTTGG + Intergenic
951751834 3:26044532-26044554 CTGGTTCTTACCATTTATTTGGG + Intergenic
952640728 3:35592049-35592071 CTAGGTGATAAATTTTATTTAGG - Intergenic
956261254 3:67344258-67344280 TTATTTTAAAACATTTATTTAGG - Intergenic
957605182 3:82389461-82389483 TGAGTTCATAAGATTTGTTTTGG - Intergenic
957832834 3:85545499-85545521 TCAGTTCATAACATATATTTTGG - Intronic
957993882 3:87663118-87663140 CTATTTCTTAACTTTTTTTTAGG - Intergenic
959941069 3:112081719-112081741 TTGGTTCATAACATTACTTTAGG - Intergenic
960113664 3:113871365-113871387 TTAATTGAAAACATTTATTTAGG + Intronic
961185228 3:124909246-124909268 TTAGTTCATATCTTATATTTTGG - Intronic
961287301 3:125816507-125816529 CTATTTCATCACATTTAGTGTGG + Intergenic
961834595 3:129646529-129646551 CCATTTCCTAACATTAATTTTGG + Intergenic
963611008 3:147468284-147468306 CTAGTTTTTAAAATTTTTTTTGG + Intronic
964610396 3:158608740-158608762 CTATTTGATTACATTTATTATGG + Intergenic
964928387 3:161984441-161984463 ATAGTTAGTAACATTTATTTGGG - Intergenic
964982866 3:162708394-162708416 CTAGTAAATAACACTTACTTTGG - Intergenic
965119020 3:164526191-164526213 CTTGGTTAAAACATTTATTTTGG + Intergenic
965175591 3:165326594-165326616 CAAGTTCTTAAGATTTATTGTGG + Intergenic
965249649 3:166326775-166326797 CTGGTTCAAAGCTTTTATTTTGG + Intergenic
965978021 3:174649441-174649463 CTTATGCATAACATATATTTAGG + Intronic
966024771 3:175263677-175263699 TTAATTTATAACATTTAATTAGG - Intronic
966912008 3:184564974-184564996 CTGGGGCATGACATTTATTTTGG + Intronic
966953639 3:184849277-184849299 TTACTTCATAACACGTATTTTGG - Intronic
967191439 3:186988490-186988512 CTAGGTCTTTACATTTATATTGG - Intronic
968158207 3:196401109-196401131 CAAGTTAAAAACATTTATCTCGG + Intronic
970521721 4:16891063-16891085 TAATTTCCTAACATTTATTTTGG + Intronic
970909593 4:21259189-21259211 GTAGTTCATACCATAAATTTTGG - Intronic
971613988 4:28764082-28764104 ATAGTATATAACATTTATATTGG - Intergenic
972346545 4:38197139-38197161 CTAATTTAAAACATTTTTTTTGG + Intergenic
973170894 4:47142192-47142214 CAAATTCATATCATTGATTTAGG + Intronic
976341410 4:83949687-83949709 CAATATAATAACATTTATTTGGG - Intergenic
976483846 4:85576964-85576986 ATACTTCATAACATTATTTTGGG + Intronic
976899911 4:90159820-90159842 ATAGTGCCTAACATTTATTGAGG + Intronic
977423200 4:96829646-96829668 TTTGTTCATAAGATATATTTTGG - Intergenic
977576122 4:98675749-98675771 CAACTTGATAATATTTATTTTGG - Intergenic
977686651 4:99854359-99854381 TTAGTTCTTGATATTTATTTGGG - Intronic
978522592 4:109632067-109632089 CTCCTTAATAACATTTATCTAGG - Intronic
979631579 4:122908105-122908127 TTAGTTTATAAGATTTTTTTGGG - Intronic
979685123 4:123503603-123503625 CAAGTGCATTACATTTATTGTGG + Intergenic
980136591 4:128863979-128864001 CTAATTCTAAACATTTTTTTTGG + Intronic
980376530 4:131956745-131956767 GTAGATCTTTACATTTATTTAGG + Intergenic
980720957 4:136694925-136694947 TTACTACATAAGATTTATTTTGG - Intergenic
981120474 4:141045176-141045198 CTACTTCATTACATTAATGTTGG - Intronic
982561988 4:156940345-156940367 ATATTTCATAACCTATATTTAGG - Intronic
984636223 4:182112476-182112498 CTAGTTTATAAGATTTCATTGGG + Intergenic
986053002 5:4107752-4107774 CTTGGCCATATCATTTATTTTGG - Intergenic
986129893 5:4919807-4919829 TTAGTTTGTCACATTTATTTTGG - Intergenic
986167314 5:5286114-5286136 CTAGTTCATCCCATTTAAATGGG - Intronic
986194043 5:5521396-5521418 CTATTTTGTAACCTTTATTTAGG - Intergenic
988270549 5:29009931-29009953 ATATTTCATAAAAGTTATTTGGG - Intergenic
991217161 5:64168758-64168780 CTTGTTAATAACTTTTTTTTTGG - Intronic
991251953 5:64572755-64572777 CTAATTCAAAACATTGCTTTGGG - Intronic
991342736 5:65629275-65629297 CTAGTTCAGATCCCTTATTTTGG + Intronic
994341472 5:98633934-98633956 ATAGGTCATAACATTTTCTTAGG - Intergenic
994700026 5:103121848-103121870 TTGGTTCATAGCACTTATTTGGG - Intronic
994987110 5:106949837-106949859 CTAGTTTATTAGATGTATTTTGG - Intergenic
995427339 5:112040390-112040412 CTAGTTAGTAACATGTATTCAGG + Intergenic
996227645 5:121020375-121020397 TTGGTTAATACCATTTATTTAGG - Intergenic
996934054 5:128927687-128927709 ATAGCTTATAACATTTAATTTGG - Intronic
998414196 5:141933776-141933798 CTGGTTAATTACATCTATTTGGG + Intronic
999504909 5:152184598-152184620 CTCATGAATAACATTTATTTAGG - Intergenic
1001089813 5:168729541-168729563 TTAATTTATAAAATTTATTTTGG - Intronic
1001183911 5:169548640-169548662 ATAGTTCATTAGATTTACTTTGG + Intergenic
1001366916 5:171151274-171151296 CTCTTTCATAATATTGATTTCGG - Intronic
1003217480 6:4127930-4127952 AAAGTGCCTAACATTTATTTTGG + Intronic
1003346435 6:5272275-5272297 CTTTTTCATAACTTTTATTACGG + Intronic
1005687444 6:28268409-28268431 CAAGTTCAAAACATTTAATATGG - Intronic
1008851740 6:56030534-56030556 CTAGTAGACAACATATATTTGGG + Intergenic
1010203655 6:73304391-73304413 ATATTACATAAAATTTATTTGGG + Intronic
1010911488 6:81563280-81563302 CTATATCAAACCATTTATTTTGG - Intronic
1011951168 6:92966629-92966651 CTACTTGGTAACATTAATTTTGG - Intergenic
1012196520 6:96348364-96348386 CTAGTTTTTAACATTTTTCTGGG + Intergenic
1012811732 6:103967359-103967381 CAATTTCAAACCATTTATTTGGG + Intergenic
1012812038 6:103971193-103971215 CTAGTTGTTAATATTTGTTTTGG - Intergenic
1013449664 6:110267541-110267563 AAAGTTCCTAACATTTGTTTTGG + Intronic
1014223792 6:118825029-118825051 CTAATTCATAACAATGATTCTGG + Intronic
1014480204 6:121926947-121926969 TTTGATCAAAACATTTATTTAGG + Intergenic
1014623488 6:123698355-123698377 CTAGGTCAAAACATTTTTTCTGG + Intergenic
1014680130 6:124418122-124418144 ATTGTTCATAACATTTTTTTTGG - Intronic
1015059649 6:128948080-128948102 CTAGTTCATAGCAAGAATTTAGG - Intronic
1016621228 6:146110826-146110848 CTAGTTACTGACATTTATTAGGG + Intronic
1017074592 6:150606107-150606129 ATAGTTTAAAACATTTACTTTGG + Intronic
1017191729 6:151661491-151661513 CAAGAGCATAGCATTTATTTTGG + Intronic
1017194215 6:151682883-151682905 CTATTTCATAAAATTTTTGTAGG - Intronic
1017196464 6:151705894-151705916 CTGGTTTATTCCATTTATTTTGG + Intronic
1017937708 6:159021159-159021181 ATTGTTCTTAACATTTATTTGGG + Intergenic
1018375458 6:163206667-163206689 CTATTTTTTAACTTTTATTTTGG - Intronic
1019195817 6:170282208-170282230 GTCATTCATAAAATTTATTTTGG + Exonic
1021055084 7:16036973-16036995 CTCATACATAACATTTCTTTAGG + Intergenic
1021497238 7:21289423-21289445 CAATTTTATTACATTTATTTAGG - Intergenic
1023592600 7:41795455-41795477 CTATTTGATAACATAAATTTTGG - Intergenic
1025282116 7:57635269-57635291 CTAATTAATAACTTTTATATTGG + Intergenic
1025302614 7:57830248-57830270 CTAATTAATAACTTTTATATTGG - Intergenic
1025535052 7:61937180-61937202 CTTCTTCCTAGCATTTATTTAGG - Intergenic
1025961708 7:66228511-66228533 CTAGTATATTCCATTTATTTAGG - Intronic
1027853436 7:83478691-83478713 CTAGTTCATAACTATTACTAGGG + Intronic
1027930747 7:84531556-84531578 CTAATTTATAATATTTATGTTGG - Intergenic
1028783372 7:94763615-94763637 ATATTTCATAACATGTATTGGGG + Intergenic
1030947975 7:115750312-115750334 CTAGGACATCACATTGATTTAGG + Intergenic
1031171375 7:118296121-118296143 CTAATTCATCACATTTCTTCAGG + Intergenic
1031707771 7:125003482-125003504 CTAGTTCAAAACATGTTTTGTGG - Intergenic
1031775240 7:125900916-125900938 GTAGTTCATAAAATTCACTTGGG - Intergenic
1032645596 7:133820547-133820569 CTCCTTCTTAACATTTGTTTTGG - Intronic
1033762900 7:144455811-144455833 CTATGTCATTACAATTATTTTGG + Intronic
1034384997 7:150733644-150733666 CTTGTCCAAAACATTCATTTGGG + Intronic
1035013693 7:155744113-155744135 CTAATTCTTAAGGTTTATTTAGG + Intronic
1036961276 8:13247397-13247419 GTAGTTGTTAACAATTATTTAGG + Intronic
1037193971 8:16165009-16165031 CTATTTCTCAAAATTTATTTAGG + Intronic
1039674435 8:39645204-39645226 ATACTTCACAACAATTATTTTGG - Intronic
1040073757 8:43208948-43208970 CTAGTACCTAGCATTTAGTTAGG - Intergenic
1040619180 8:49070659-49070681 GTTGTTAATATCATTTATTTAGG - Intronic
1041068912 8:54107269-54107291 CTTGTTAATAATGTTTATTTTGG - Intergenic
1042268593 8:66933958-66933980 CTAGTTCATTCTATTTAATTTGG - Intergenic
1042551514 8:69997778-69997800 ATAGTTCTTAAGATTTTTTTTGG - Intergenic
1042590248 8:70391152-70391174 CTACTTCATAACTTTGAATTTGG - Intronic
1043166048 8:76903792-76903814 CTAGGTCAGGAAATTTATTTAGG + Intergenic
1043300569 8:78725833-78725855 ATAATTCATAACATTTACTGAGG - Intronic
1044480997 8:92687947-92687969 ATAGTTGACAACATTTTTTTAGG + Intergenic
1047058466 8:121194359-121194381 ATAGTTTATATGATTTATTTAGG - Intergenic
1048481828 8:134803569-134803591 GTAGTTTATAAGACTTATTTGGG - Intergenic
1051070461 9:13159954-13159976 ATAGTTGATAACATTTTTGTTGG - Intronic
1051099184 9:13501555-13501577 TTATTTCATAAGATTGATTTTGG - Intergenic
1052013146 9:23434608-23434630 CTATTTCATAACCTTTGTTCTGG - Intergenic
1052044177 9:23775369-23775391 ATAGTGCATAAGATTTGTTTTGG - Intronic
1052293886 9:26876057-26876079 CTAGTTCTTAAGACTTATTTTGG - Intronic
1052583227 9:30389177-30389199 CTATTTCCTTTCATTTATTTTGG + Intergenic
1052614336 9:30819124-30819146 CATGTTAATAATATTTATTTTGG - Intergenic
1052732109 9:32299911-32299933 CTTGTAGATAACATATATTTTGG - Intergenic
1053635681 9:39998919-39998941 CTAGTCCATATCATGCATTTGGG + Intergenic
1054208205 9:62251780-62251802 CTAGTCCATATCATGCATTTGGG - Intergenic
1054316556 9:63596036-63596058 CTAGTCCATATCACTCATTTGGG + Intergenic
1054548976 9:66377209-66377231 CTAGTCCATATCATGCATTTGGG - Intergenic
1055001541 9:71455786-71455808 CAAAATCATAGCATTTATTTTGG + Intergenic
1057639737 9:96807260-96807282 TTAGTTGATCACATATATTTGGG - Intergenic
1057885645 9:98827669-98827691 GAAATTCATAACATTTATCTGGG - Intronic
1058786753 9:108395240-108395262 CTAGTTAAAAAAATTTTTTTTGG - Intergenic
1060911041 9:127350907-127350929 GTAACTCATATCATTTATTTAGG - Intronic
1202789352 9_KI270719v1_random:70512-70534 GTAGTTCTTTACATTTATTTAGG + Intergenic
1203633187 Un_KI270750v1:88891-88913 CTAATTAATAACTTTTATATTGG + Intergenic
1188983805 X:36751819-36751841 CTAGAACTTAACATGTATTTGGG - Intergenic
1189401285 X:40671147-40671169 CTAGGTCATCAGATTTATTGGGG - Intronic
1189475373 X:41349408-41349430 CTAGATTCTAAAATTTATTTGGG + Exonic
1193462070 X:81802945-81802967 ATAATGCATAGCATTTATTTAGG + Intergenic
1194181643 X:90717260-90717282 CTAGTACTTAAAATTTTTTTTGG - Intergenic
1194496978 X:94628441-94628463 CTACTGCATAAGATTTTTTTGGG + Intergenic
1194688302 X:96951893-96951915 CTATTAGATCACATTTATTTTGG - Intronic
1194885258 X:99307419-99307441 CTAGTTCTCTACATTTATTAAGG - Intergenic
1194928649 X:99860715-99860737 CTAGGTCATAACATTGGTTGTGG - Intergenic
1195290448 X:103427678-103427700 TTAATTCACACCATTTATTTGGG + Intergenic
1196572997 X:117284995-117285017 CTTGTAGATAGCATTTATTTAGG + Intergenic
1197334134 X:125191146-125191168 TTATTTCATATTATTTATTTAGG + Intergenic
1200528269 Y:4299174-4299196 CTAGTACTTAAAATTTTTTTTGG - Intergenic
1201498901 Y:14620168-14620190 CTTTTTTATAACTTTTATTTTGG - Intronic