ID: 1119375694

View in Genome Browser
Species Human (GRCh38)
Location 14:74190685-74190707
Sequence CTAAAGTTCTTTAGGTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119375694_1119375698 -8 Left 1119375694 14:74190685-74190707 CCTGGCCACCTAAAGAACTTTAG 0: 1
1: 0
2: 0
3: 13
4: 123
Right 1119375698 14:74190700-74190722 AACTTTAGGCAAAAGCCTCAAGG 0: 1
1: 0
2: 1
3: 14
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119375694 Original CRISPR CTAAAGTTCTTTAGGTGGCC AGG (reversed) Intronic
902431339 1:16365982-16366004 AAAAAGTTATTTATGTGGCCGGG - Intronic
903376157 1:22867488-22867510 CTATAGTTCTTTTGGGGCCCTGG + Intronic
908758536 1:67491019-67491041 ATAAAGTGCTTGAGGTTGCCGGG + Intergenic
910776936 1:90886338-90886360 CTAAAGATCTGCAGGGGGCCGGG + Intergenic
913575750 1:120172713-120172735 CTAAATATTTTTAGGTGGACTGG - Intronic
914558064 1:148788285-148788307 CTAAATATTTTTAGGTGGACTGG - Intergenic
914614770 1:149341945-149341967 CTAAATATTTTTAGGTGGACTGG + Intergenic
917492490 1:175509501-175509523 GAGAAGTTCTTTAGGTGCCCAGG - Intronic
919985358 1:202670373-202670395 CTAAATTTCCTTTGGTGCCCAGG + Intronic
920239051 1:204530297-204530319 CTAAAGTCGTTTATGTGCCCTGG + Intronic
923846887 1:237744358-237744380 AAAAAGCTTTTTAGGTGGCCAGG + Intronic
1064461418 10:15538215-15538237 AAAAAGTTCTATAGTTGGCCAGG + Intronic
1067394040 10:45895465-45895487 CTACACTTCTTTAAGTGTCCTGG + Intergenic
1067862364 10:49864598-49864620 CTACACTTCTTTAAGTGTCCTGG + Intronic
1068710613 10:60129454-60129476 TAAAAGTTCTCCAGGTGGCCGGG + Intronic
1072106280 10:92277593-92277615 CTAAGATTCTTTTGGTGGCTGGG + Intronic
1073020952 10:100443547-100443569 TTAAATTTCTTTATCTGGCCAGG + Intergenic
1080594724 11:33761043-33761065 CTAAAGTTCTTTCATTGTCCAGG + Intronic
1081582589 11:44362452-44362474 CTAATGTTCTCCAGGAGGCCTGG - Intergenic
1081751180 11:45512259-45512281 GTAAAATTCTATATGTGGCCGGG - Intergenic
1083109123 11:60387688-60387710 CTAAAGTTGTTGAGGAAGCCAGG - Intronic
1083370656 11:62176801-62176823 CTAAAGTTTTTGATCTGGCCGGG - Intergenic
1085336610 11:75701404-75701426 CCTAAGTTCTTTGGGAGGCCTGG + Intergenic
1085497494 11:76984284-76984306 CCAAAGGTCTTTAGGAGGCCTGG - Intronic
1085551765 11:77380196-77380218 CTAAAGTACGGGAGGTGGCCGGG + Intronic
1087468574 11:98542384-98542406 CTAAAGTTGTTTGATTGGCCAGG - Intergenic
1088468815 11:110172457-110172479 GTTAACTTCTTTAGCTGGCCTGG + Intergenic
1090699973 11:129285265-129285287 CTACAGTTCTTAAGTTGCCCAGG - Intergenic
1091107817 11:132939235-132939257 CTAAAGTTCTGTTGTTTGCCTGG - Intronic
1097404055 12:59166992-59167014 AGAAAGTTCATTAAGTGGCCTGG - Intergenic
1107567624 13:41622116-41622138 ATATAGTTCTTTAGGTGGATGGG + Intronic
1110250085 13:73371639-73371661 CTGAAGTTGTTTAGAAGGCCAGG - Intergenic
1111222567 13:85223303-85223325 TTAATTTTCTTTTGGTGGCCAGG - Intergenic
1111705818 13:91748422-91748444 TTAAAGTTCTTTAAGTGCACAGG - Intronic
1111745600 13:92265194-92265216 TTAAAATTCTTTATATGGCCAGG + Intronic
1111764598 13:92512313-92512335 CTAAAGTACTTAAGGTGACTCGG - Intronic
1111805577 13:93037186-93037208 CTAAAGTTTTTTAATTGGTCAGG + Intergenic
1111851801 13:93584983-93585005 TTAAAGTTTATAAGGTGGCCGGG - Intronic
1112299868 13:98220094-98220116 CTAAAGGTCTTGAGGGGGCGGGG + Intronic
1113394420 13:109933350-109933372 CCAAAAATCTTTAGGAGGCCAGG + Intergenic
1115834439 14:37382577-37382599 CTAAAGTTCTTTAGATGAACTGG - Intronic
1116756330 14:48953273-48953295 TTATAATTCTTTAGATGGCCTGG - Intergenic
1117172104 14:53111158-53111180 ATAAAGATATTTATGTGGCCGGG + Intronic
1119375694 14:74190685-74190707 CTAAAGTTCTTTAGGTGGCCAGG - Intronic
1119778713 14:77264391-77264413 CCACAGCTCTCTAGGTGGCCTGG - Intergenic
1121013272 14:90534148-90534170 CTGAAGGTCTTTTGGGGGCCAGG - Exonic
1202897276 14_GL000194v1_random:17428-17450 CTGGAGTTCTTTCGGTGTCCAGG - Intergenic
1128962805 15:72025643-72025665 GTCAAGTTCTTTTTGTGGCCGGG - Intronic
1131530747 15:93189790-93189812 CTGAAGGTCTTTAGATCGCCAGG - Intergenic
1132077554 15:98835039-98835061 CTTAGGCTTTTTAGGTGGCCAGG + Intronic
1133834366 16:9352912-9352934 TTAAAGTGCTGTGGGTGGCCAGG - Intergenic
1140381624 16:74493806-74493828 CTAAACTTCTTGAGGAGGCAGGG + Intronic
1142636541 17:1261074-1261096 CTAAAGTTCTATATGAGGCTGGG + Intergenic
1143356760 17:6335344-6335366 AAAAAGGTCTTTAGGAGGCCGGG - Intergenic
1143892188 17:10111103-10111125 CAAAAGTCCTTAAGGGGGCCGGG + Intronic
1154037986 18:10825157-10825179 ATAAAGGACATTAGGTGGCCGGG - Intronic
1155649112 18:28119048-28119070 CTCAAGTTCTTTATGTTCCCTGG - Intronic
1156340033 18:36202487-36202509 CTAAATTTCCTAGGGTGGCCAGG - Intronic
1161305107 19:3563159-3563181 CAAAAATACTTTGGGTGGCCAGG - Intronic
1161332051 19:3693101-3693123 CCAGAGTTCCTTAGGGGGCCTGG + Intronic
1163045747 19:14640584-14640606 CTAAAGTTGTCTCGGTGGCCGGG - Intronic
1165647150 19:37451102-37451124 ATAAAGTTGTGTAGATGGCCAGG + Intronic
926240658 2:11082277-11082299 CAAAAGTTCTTTATTAGGCCTGG - Intergenic
928265384 2:29807007-29807029 TGAAAGTACTTTAGGTGGTCGGG - Intronic
931343831 2:61427865-61427887 CTAAAGAGTTTTTGGTGGCCAGG + Intronic
933532475 2:83527641-83527663 CCAATTTTGTTTAGGTGGCCAGG - Intergenic
935823668 2:106919546-106919568 CTAAAGTACTTTACTTGGCCCGG + Intergenic
936046917 2:109195473-109195495 CTACAGCTCTTTATGTGGCAAGG - Intronic
942447817 2:176089948-176089970 ATCAGTTTCTTTAGGTGGCCAGG - Intergenic
943701971 2:190996569-190996591 CTAAAGCCCTTCAGGTGGCCAGG - Intronic
944564280 2:200971535-200971557 GTAAAGGTCTTTATCTGGCCCGG - Intergenic
1169083075 20:2809372-2809394 CTTAAGATCTTTAACTGGCCGGG + Intergenic
1176026856 20:62990207-62990229 CTAACGTTCCTGGGGTGGCCCGG + Intergenic
1176616960 21:9033417-9033439 CTGGAGTTCTTTCGGTGTCCAGG - Intergenic
950402699 3:12782228-12782250 CTAAAGTCATTTAGGAGGTCAGG + Intergenic
950576887 3:13837383-13837405 CCAAAGTACCTCAGGTGGCCGGG - Intronic
953450034 3:42998090-42998112 CTGAAGTCCTTTAGGTGGTCTGG + Intronic
958858626 3:99418266-99418288 CTAAAGTGCTATAGGAGGACAGG + Intergenic
958903305 3:99913527-99913549 CTAAAGCTCATAAGGTGGCCTGG + Intronic
963615447 3:147531276-147531298 CTAAAGTTTATTAGGAAGCCAGG + Intergenic
963670696 3:148248546-148248568 CTAAAAGTATATAGGTGGCCAGG + Intergenic
963763258 3:149307321-149307343 CTAAAGGTCTTAAGTGGGCCTGG - Intergenic
967156707 3:186699013-186699035 CTAATGTTCTTTAGAAGGTCTGG + Intergenic
967482172 3:189986287-189986309 TTAAAGTTCATCAGATGGCCGGG + Intronic
967506119 3:190254819-190254841 ATAAAGTTCTCAAGGTGGCCGGG + Intergenic
968165206 3:196459302-196459324 TAAAGGTTCTCTAGGTGGCCGGG + Intergenic
971002717 4:22340634-22340656 ATGAAGTTCTTTAGTTGGTCTGG + Intergenic
971876603 4:32316838-32316860 ATTATGTTCTTTAGGAGGCCTGG - Intergenic
981828319 4:148970790-148970812 CTAAGATTCTTGAGGGGGCCAGG - Intergenic
984038759 4:174702938-174702960 CAACAGTTCTTTAGCAGGCCTGG + Intronic
984397776 4:179223053-179223075 TTAAAGTTCTATAGGTTGCAAGG + Intergenic
989597895 5:43173930-43173952 CAAAATGTATTTAGGTGGCCAGG + Intronic
991074309 5:62518006-62518028 CTAAAGTTTATTGGTTGGCCAGG + Intronic
991380290 5:66015534-66015556 CTAAAATTTTTTAGGTGTACAGG + Intronic
992208554 5:74454824-74454846 CAAAAGTTCATTTGGAGGCCAGG + Intergenic
992685683 5:79197366-79197388 TTAAAACTCTTTAGTTGGCCTGG + Intronic
995174243 5:109156271-109156293 CTTAAGTTCATAAGGTGGACAGG + Intronic
995836990 5:116409111-116409133 CTAAAGTTCATATGTTGGCCGGG + Intronic
999206063 5:149848823-149848845 GTAAAGTTGTTTTGGTGGCTGGG + Exonic
1004152701 6:13135272-13135294 CTGAAGGTCTTTAGATCGCCAGG + Intronic
1004626375 6:17381018-17381040 CGAAAGTTCTTTTGGTGGCTGGG + Intergenic
1004783493 6:18939255-18939277 CTAAAATTTTCTAGGTGACCAGG + Intergenic
1005996138 6:30932456-30932478 CTAAAGATCCTTGGGAGGCCCGG - Intergenic
1011963647 6:93124080-93124102 CTAGAGTTGTTTAGATTGCCAGG + Intergenic
1012707390 6:102548985-102549007 CCAAAGTTCCTTTGGTGGCTGGG + Intergenic
1013507068 6:110811541-110811563 AAAAAGTTCTTTTGTTGGCCGGG - Intronic
1013517519 6:110901803-110901825 CTAAAATGCTAAAGGTGGCCGGG - Intergenic
1014305072 6:119730026-119730048 TTAAAGTTCTCTAGGTACCCAGG - Intergenic
1017088491 6:150737064-150737086 CTAAAGTTTTCTAGGAGGACAGG - Intronic
1018483232 6:164213084-164213106 TTATAGTTCTTCATGTGGCCAGG - Intergenic
1024633446 7:51267867-51267889 CCAAAGTTCTTTTTTTGGCCGGG - Intronic
1025974498 7:66359114-66359136 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974536 7:66359300-66359322 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974548 7:66359360-66359382 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974561 7:66359423-66359445 CTAAGGTTCTTCAAGTGTCCAGG - Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1026836185 7:73641004-73641026 CTAAAGATCTGTAGGGGGCCAGG + Intergenic
1027483012 7:78723054-78723076 CTTAATATCTTAAGGTGGCCTGG - Intronic
1029431349 7:100533001-100533023 CTAAAATTTTTTTGCTGGCCGGG + Intergenic
1030516049 7:110539324-110539346 ATAAAATTCTTTAGATGACCTGG + Intergenic
1034604888 7:152302937-152302959 CTAAAGTTCCTTTCTTGGCCAGG - Intronic
1040018810 8:42722076-42722098 ATAAAGATCTCTTGGTGGCCAGG + Intronic
1042060845 8:64815783-64815805 CCATAGTGCTTCAGGTGGCCTGG - Intergenic
1046972950 8:120243040-120243062 ATTAAGTTCTTTAAATGGCCCGG + Intronic
1055081419 9:72270905-72270927 CTAATGTCCTTTATTTGGCCTGG - Intergenic
1056035339 9:82598986-82599008 TTAAAGATCTTTTGGTGACCTGG - Intergenic
1058696193 9:107560994-107561016 AAAAAGTTTTTTAGGTAGCCAGG - Intergenic
1059212007 9:112522264-112522286 AAAAAGTTCTTTAAGTGGCTGGG - Intronic
1061985913 9:134130112-134130134 CTAAAGTTCTTAGGTGGGCCGGG + Intergenic
1186786635 X:12962158-12962180 CCAAAGTTCTTAAAATGGCCTGG + Intergenic
1186872822 X:13789442-13789464 CCAGAATTCTTAAGGTGGCCTGG - Intronic
1195473949 X:105263178-105263200 TTAAAAATCTTTAGGGGGCCAGG - Intronic
1195715740 X:107817147-107817169 GTAAAGTTCTTGGGGTAGCCAGG + Intergenic
1197034976 X:121862426-121862448 CTAAAGTTTTTTAATTGTCCAGG - Intergenic
1197599194 X:128507878-128507900 TTTAAATTCTTTATGTGGCCAGG - Intergenic
1199880075 X:151967164-151967186 CTAAATTTCCTTAGGTGGAGTGG - Intronic
1201150360 Y:11092268-11092290 CTGGAGTTCTTTCGGTGTCCAGG - Intergenic