ID: 1119375839

View in Genome Browser
Species Human (GRCh38)
Location 14:74192087-74192109
Sequence ATCTTCCAATGCAAGATAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 523
Summary {0: 1, 1: 0, 2: 1, 3: 84, 4: 437}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119375839_1119375841 13 Left 1119375839 14:74192087-74192109 CCATTTATCTTGCATTGGAAGAT 0: 1
1: 0
2: 1
3: 84
4: 437
Right 1119375841 14:74192123-74192145 AATAGGTCTTTTGTCACTCCTGG 0: 1
1: 0
2: 1
3: 5
4: 93
1119375839_1119375840 -4 Left 1119375839 14:74192087-74192109 CCATTTATCTTGCATTGGAAGAT 0: 1
1: 0
2: 1
3: 84
4: 437
Right 1119375840 14:74192106-74192128 AGATCTTTTTAGAAATAAATAGG 0: 1
1: 0
2: 3
3: 68
4: 697

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119375839 Original CRISPR ATCTTCCAATGCAAGATAAA TGG (reversed) Intronic
900831831 1:4971082-4971104 ATCTTTCAAGGAGAGATAAATGG + Intergenic
903089544 1:20899467-20899489 CTCTTCCAATGCCAGTAAAAGGG + Intronic
903895946 1:26604555-26604577 ATCTTCAAATGCCAGACATAGGG - Intergenic
904554871 1:31354064-31354086 ATCTTCCAATCCATGAAAATTGG + Intronic
905005795 1:34709364-34709386 ATCTTCCAATTCAAGAGATAAGG + Intergenic
905972751 1:42153944-42153966 ATCTTGCAATGCCAGCTCAAGGG - Intronic
907373699 1:54018958-54018980 ATTTCCCAATGCAAAAGAAAAGG - Intergenic
909218995 1:72930218-72930240 ATTTTCAAATTCAGGATAAAAGG - Intergenic
909262006 1:73502123-73502145 AGGTTCCCATACAAGATAAAAGG + Intergenic
909648640 1:77947814-77947836 ATCTGCCATTGAAACATAAATGG - Intronic
909933026 1:81520026-81520048 ATGTTCAAAGGCAAGAAAAAAGG - Intronic
911872226 1:103112571-103112593 ATTTTCCAATCAAAGATAGAAGG + Intergenic
913126086 1:115791777-115791799 ATCTTCTCATGGAAGATCAATGG - Intergenic
913722516 1:121612712-121612734 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913722717 1:121615586-121615608 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913723351 1:121624124-121624146 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913723671 1:121628121-121628143 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913725183 1:121645612-121645634 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913725512 1:121649343-121649365 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913726009 1:121654939-121654961 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913726833 1:121664267-121664289 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913729568 1:121695980-121696002 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913729724 1:121697846-121697868 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913729880 1:121699712-121699734 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913730037 1:121701578-121701600 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913730193 1:121703444-121703466 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913730348 1:121705310-121705332 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913730654 1:121709042-121709064 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913730807 1:121710908-121710930 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913731115 1:121714640-121714662 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913731264 1:121716506-121716528 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913733011 1:121737328-121737350 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913733155 1:121739192-121739214 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913733361 1:121741904-121741926 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913739529 1:121825556-121825578 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913740116 1:121833511-121833533 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913741447 1:121849564-121849586 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913742276 1:121859970-121859992 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913742477 1:121862844-121862866 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913742768 1:121866842-121866864 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913743811 1:121878782-121878804 ATCTTCCCATGAAAGCTAAACGG - Intergenic
913744124 1:121882516-121882538 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913744434 1:121886249-121886271 ATCTTCCCATGAAAGCTAAACGG - Intergenic
913745108 1:121894408-121894430 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913745263 1:121896274-121896296 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913745828 1:121903310-121903332 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913745985 1:121905176-121905198 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913748629 1:121936021-121936043 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913748930 1:121939751-121939773 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913750125 1:121954335-121954357 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913750477 1:121959295-121959317 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913750631 1:121961161-121961183 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913751927 1:122027790-122027812 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913752084 1:122029657-122029679 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913752393 1:122033390-122033412 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913753718 1:122048662-122048684 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913754362 1:122056131-122056153 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913754665 1:122059945-122059967 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913754985 1:122063677-122063699 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913757252 1:122089974-122089996 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913758223 1:122101176-122101198 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913759718 1:122118772-122118794 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913761394 1:122137770-122137792 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913763337 1:122160162-122160184 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913768294 1:122217894-122217916 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913768894 1:122224954-122224976 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913769037 1:122226820-122226842 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913769174 1:122228688-122228710 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913769358 1:122231063-122231085 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913769494 1:122232929-122232951 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913769632 1:122234796-122234818 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913769759 1:122236664-122236686 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913769904 1:122238613-122238635 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913770042 1:122240478-122240500 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913770180 1:122242345-122242367 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913770323 1:122244211-122244233 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913770463 1:122246077-122246099 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913770602 1:122247943-122247965 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913770742 1:122249809-122249831 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913770886 1:122251675-122251697 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913771025 1:122253543-122253565 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913771166 1:122255409-122255431 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913771304 1:122257275-122257297 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913771444 1:122259140-122259162 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913771585 1:122261006-122261028 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913771766 1:122263546-122263568 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913771905 1:122265412-122265434 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913772184 1:122269144-122269166 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913772319 1:122271008-122271030 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913772457 1:122272875-122272897 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913772599 1:122274741-122274763 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913772739 1:122276607-122276629 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913772880 1:122278473-122278495 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913773016 1:122280340-122280362 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913773158 1:122282206-122282228 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913773292 1:122284071-122284093 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913773434 1:122285937-122285959 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913773715 1:122289669-122289691 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913773853 1:122291535-122291557 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913773994 1:122293401-122293423 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913774134 1:122295267-122295289 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913774269 1:122297133-122297155 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913774409 1:122298999-122299021 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913774552 1:122300865-122300887 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913774691 1:122302731-122302753 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913774830 1:122304597-122304619 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913774968 1:122306463-122306485 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913775106 1:122308329-122308351 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913775245 1:122310195-122310217 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913775384 1:122312061-122312083 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913775800 1:122317659-122317681 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913775939 1:122319527-122319549 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913776223 1:122323259-122323281 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913776365 1:122325128-122325150 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913776507 1:122326994-122327016 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913776648 1:122328859-122328881 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913776789 1:122330724-122330746 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913776929 1:122332590-122332612 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913777067 1:122334457-122334479 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913777205 1:122336322-122336344 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913777348 1:122338188-122338210 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913777481 1:122340040-122340062 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913777624 1:122341906-122341928 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913777763 1:122343775-122343797 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913777901 1:122345641-122345663 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913778045 1:122347507-122347529 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913778186 1:122349369-122349391 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913778327 1:122351235-122351257 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913778467 1:122353100-122353122 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913778609 1:122354966-122354988 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913778747 1:122356832-122356854 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913778881 1:122358697-122358719 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913779022 1:122360562-122360584 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913779165 1:122362430-122362452 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913779307 1:122364296-122364318 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913779446 1:122366162-122366184 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913779720 1:122369894-122369916 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913779863 1:122371760-122371782 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913780001 1:122373627-122373649 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913780139 1:122375492-122375514 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913780280 1:122377358-122377380 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913780418 1:122379224-122379246 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913780558 1:122381089-122381111 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913780698 1:122382957-122382979 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913780838 1:122384823-122384845 ATCTTCCCATAAAAGATAAACGG + Intergenic
913780976 1:122386688-122386710 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913781131 1:122388560-122388582 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913781269 1:122390426-122390448 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913781406 1:122392292-122392314 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913781540 1:122394158-122394180 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913781680 1:122396024-122396046 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913781826 1:122397890-122397912 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913781963 1:122399756-122399778 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913782102 1:122401620-122401642 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913782242 1:122403487-122403509 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913782386 1:122405354-122405376 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913782528 1:122407220-122407242 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913782667 1:122409086-122409108 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913782806 1:122410953-122410975 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913782948 1:122412820-122412842 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913783091 1:122414686-122414708 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913783235 1:122416555-122416577 ATCTTCCCATAAAAGATAAACGG + Intergenic
913783367 1:122418420-122418442 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913783505 1:122420286-122420308 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913783644 1:122422153-122422175 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913783781 1:122424018-122424040 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913784059 1:122427750-122427772 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913784180 1:122429279-122429301 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913784319 1:122431143-122431165 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913784457 1:122433010-122433032 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913784597 1:122434876-122434898 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913784874 1:122438607-122438629 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913785009 1:122440473-122440495 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913785150 1:122442339-122442361 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913785292 1:122444205-122444227 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913785431 1:122446071-122446093 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913785575 1:122447939-122447961 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913785713 1:122449805-122449827 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913785872 1:122451842-122451864 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913786151 1:122455574-122455596 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913786284 1:122457439-122457461 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913786427 1:122459305-122459327 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913786568 1:122461171-122461193 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913786720 1:122463234-122463256 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913786857 1:122465100-122465122 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913786996 1:122466967-122466989 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913787130 1:122468833-122468855 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913787270 1:122470697-122470719 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913787408 1:122472563-122472585 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913787549 1:122474426-122474448 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913787687 1:122476293-122476315 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913787823 1:122478160-122478182 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913788101 1:122481891-122481913 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913788242 1:122483757-122483779 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913788385 1:122485622-122485644 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913788521 1:122487489-122487511 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913788660 1:122489355-122489377 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913788938 1:122493086-122493108 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913789078 1:122494952-122494974 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913789212 1:122496845-122496867 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913789352 1:122498711-122498733 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913789496 1:122500578-122500600 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913789636 1:122502444-122502466 ATCTTCCCATGAAAGCTAAACGG + Intergenic
913916999 1:124785851-124785873 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913917131 1:124787381-124787403 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913917268 1:124788911-124788933 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913917395 1:124790441-124790463 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913917523 1:124791974-124791996 ATCTTCCCATAAAAGCTAAATGG + Intergenic
913917656 1:124793504-124793526 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913917784 1:124795034-124795056 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913917912 1:124796566-124796588 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913918044 1:124798096-124798118 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913918174 1:124799626-124799648 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913918307 1:124801156-124801178 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913918570 1:124804215-124804237 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913918699 1:124805745-124805767 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913918829 1:124807275-124807297 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913918963 1:124808804-124808826 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913919360 1:124813395-124813417 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913919494 1:124814925-124814947 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913919628 1:124816455-124816477 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913919888 1:124819517-124819539 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913920017 1:124821047-124821069 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913920147 1:124822577-124822599 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913920278 1:124824108-124824130 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913920415 1:124825640-124825662 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913920547 1:124827171-124827193 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913920688 1:124828701-124828723 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913920825 1:124830231-124830253 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913920955 1:124831761-124831783 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913921086 1:124833291-124833313 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913921218 1:124834821-124834843 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913921345 1:124836352-124836374 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913921476 1:124837881-124837903 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913921611 1:124839414-124839436 ATCTTCCCATAAAAGCTAAATGG + Intergenic
913921743 1:124840945-124840967 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913921875 1:124842475-124842497 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913922008 1:124844005-124844027 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913922138 1:124845535-124845557 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913922269 1:124847065-124847087 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913922403 1:124848596-124848618 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913922540 1:124850398-124850420 ATCTTCCCATAAAAGCTAAATGG + Intergenic
913922660 1:124851928-124851950 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913922780 1:124853457-124853479 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913922899 1:124854986-124855008 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913923022 1:124856513-124856535 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913923143 1:124858043-124858065 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913923269 1:124859573-124859595 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913923516 1:124862634-124862656 ATCTTCCCATAAAAGCTAAATGG + Intergenic
913923630 1:124864162-124864184 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913923757 1:124865692-124865714 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913923878 1:124867222-124867244 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913923994 1:124868750-124868772 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913924113 1:124870280-124870302 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913924239 1:124871811-124871833 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913924362 1:124873344-124873366 ATCTTCCCATAAAAGCTAAATGG + Intergenic
913924487 1:124874872-124874894 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913924607 1:124876401-124876423 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913924732 1:124877931-124877953 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913924857 1:124879464-124879486 ATCTTCCCATAAAAGCTAAATGG + Intergenic
913924974 1:124880994-124881016 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913925097 1:124882524-124882546 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913925219 1:124884053-124884075 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913925342 1:124885586-124885608 ATCTTCCCATAAAAGCTAAATGG + Intergenic
913925464 1:124887119-124887141 ATCTTCCCATAAAAGCTAAATGG + Intergenic
913925584 1:124888649-124888671 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913925709 1:124890182-124890204 ATCTTCCCATAAAAGCTAAATGG + Intergenic
913925831 1:124891713-124891735 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913925956 1:124893243-124893265 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913926078 1:124894773-124894795 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913926203 1:124896303-124896325 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913926326 1:124897834-124897856 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913926454 1:124899364-124899386 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913926574 1:124900893-124900915 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913926700 1:124902427-124902449 ATCTTCCCATAAAAGCTAAATGG + Intergenic
913926815 1:124903956-124903978 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913926930 1:124905488-124905510 ATCTTCCCATAAAAGCTAAATGG + Intergenic
913927055 1:124907017-124907039 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913927172 1:124908550-124908572 ATCTTCCCATAAAAGCTAAATGG + Intergenic
913927418 1:124911613-124911635 ATCTTCCCATAAAAGCTAAATGG + Intergenic
913927666 1:124914674-124914696 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913927790 1:124916202-124916224 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913927913 1:124917731-124917753 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913928031 1:124919264-124919286 ATCTTCCCATAAAAGCTAAATGG + Intergenic
913928150 1:124920794-124920816 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913928274 1:124922323-124922345 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913928395 1:124923853-124923875 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913928518 1:124925389-124925411 ATCTTCCCATAAAAGCTAAATGG + Intergenic
913928635 1:124926919-124926941 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913928759 1:124928452-124928474 ATCTTCCCATAAAAGCTAAATGG + Intergenic
913929002 1:124931515-124931537 ATCTTCCCATAAAAGCTAAACGG + Intergenic
913929151 1:124933377-124933399 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913929270 1:124934907-124934929 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913929391 1:124936437-124936459 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913929511 1:124937967-124937989 ATCTTCCCATAAAAGCTAAACGG - Intergenic
913929629 1:124939497-124939519 ATCTTCCCATAAAAGCTAAACGG - Intergenic
915042133 1:152977453-152977475 TTCTTCCTATGAAAGAAAAAGGG - Intergenic
915269682 1:154744981-154745003 ATCTTAAAATGTAAAATAAATGG + Intronic
915405448 1:155656616-155656638 TGCTTCAAATGCAAGAAAAATGG - Intergenic
916693955 1:167218515-167218537 ATCTTCCCATCCTAGATAACTGG + Intergenic
917852161 1:179074073-179074095 ATCTTTCAATGCAAGAAAACTGG - Exonic
918540250 1:185624505-185624527 AACTGCCAATGAAAGAGAAAAGG + Intergenic
918691366 1:187484185-187484207 ACTTTCCATTGCATGATAAATGG + Intergenic
918828553 1:189360081-189360103 AACATAAAATGCAAGATAAATGG - Intergenic
919201909 1:194365907-194365929 ATCTTCTAAGGGAAGATAGAGGG - Intergenic
919948783 1:202342881-202342903 ATCTTCCAACGCTAGATGCATGG + Intergenic
923349326 1:233088256-233088278 ATCTTCCCATGCCAGAAAGACGG + Intronic
923977756 1:239283206-239283228 ACCTGCCATTTCAAGATAAATGG - Intergenic
924262820 1:242249492-242249514 ATCTTTCAAAGAAAGTTAAAAGG + Intronic
1063029533 10:2219437-2219459 AGCTTCGTAGGCAAGATAAATGG + Intergenic
1065256703 10:23876776-23876798 TTCTTCCAATAGAAAATAAATGG + Intronic
1065824716 10:29560032-29560054 ATCTTCCAAAGAAATATAAGTGG + Intronic
1066511670 10:36105692-36105714 ATCTTTCAAAGCTGGATAAAAGG - Intergenic
1066725416 10:38387438-38387460 ATCTTTCAAAGAAAGTTAAAAGG - Intergenic
1068877981 10:62017972-62017994 TTCTTTCAAAGTAAGATAAATGG - Intronic
1069291337 10:66784536-66784558 ATCTGGCAATGGAAGAAAAAAGG - Intronic
1069724432 10:70568062-70568084 ATTTTCCAATACTGGATAAATGG - Exonic
1071117047 10:82233702-82233724 GTCTTCCCTTTCAAGATAAATGG + Intronic
1072445897 10:95498236-95498258 TTCTTCCTCTGTAAGATAAAAGG + Intronic
1074859983 10:117502777-117502799 ATCTCCCAGTGCAAATTAAAAGG + Intergenic
1076396584 10:130142715-130142737 ATCATCCAATGCAACAGGAAAGG - Intronic
1079954568 11:26846868-26846890 TTCTTCCAATGCAAAATCCATGG - Intergenic
1080989071 11:37508240-37508262 ATGTTCCCATGAAAGATAAAGGG - Intergenic
1081596790 11:44465011-44465033 ATTTTACAATGGAAGAGAAAGGG + Intergenic
1082303156 11:50535924-50535946 ATCTTCAGATGAAAGGTAAAAGG - Intergenic
1085097141 11:73770459-73770481 ATCTGTCACTGCAAGAGAAATGG + Intergenic
1088192818 11:107244541-107244563 ATATTCCATTGCATGATATAAGG - Intergenic
1090624807 11:128597421-128597443 ATCTTCTGATGAAAGATAAAAGG - Intergenic
1091643275 12:2253793-2253815 ATCTTCCATTGCAACATGAGAGG - Intronic
1093099600 12:15011701-15011723 ATATTTCAAAGAAAGATAAAGGG - Intergenic
1093791914 12:23261704-23261726 ATTTTTAAATGCAAGATAGAAGG + Intergenic
1093985484 12:25527425-25527447 AGCTCTCAATGCAAGTTAAAAGG - Intronic
1095077876 12:37954696-37954718 ATCTTCCAATACAAACTAGATGG - Intergenic
1099204065 12:79708343-79708365 AATTTTCAATGGAAGATAAAGGG - Intergenic
1099611079 12:84871190-84871212 AACTGCAAATGCAAAATAAAAGG + Intronic
1101091546 12:101291630-101291652 TTCTTCCAAAGCAAGAGAATGGG + Intronic
1101732511 12:107438261-107438283 ATCTGTCAATGCATGAAAAAAGG - Intronic
1105913057 13:24889308-24889330 ATCTTCCAATGCAAGGTAAGAGG - Exonic
1106152518 13:27119456-27119478 ATCTTCACTTGCAAAATAAAAGG + Intronic
1107254340 13:38405686-38405708 ATTTTCCATTCCAAGATAGAAGG + Intergenic
1108081737 13:46744309-46744331 CCCTTCCAATGTTAGATAAAAGG + Intronic
1108804893 13:54142271-54142293 ATCTTGCTATTCAAGATGAAGGG - Intergenic
1109019837 13:57075195-57075217 CTCTTCAAAAGTAAGATAAAAGG + Intergenic
1109225260 13:59686352-59686374 TTCTTACAGTGTAAGATAAAAGG - Intronic
1109742924 13:66579482-66579504 ATATTCCAATGGTAGAAAAATGG + Intronic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1110533110 13:76619402-76619424 TTCTTCCATTTCCAGATAAATGG - Intergenic
1111111914 13:83722577-83722599 AACTTCCATTGCATGATAAAAGG + Intergenic
1111264614 13:85792521-85792543 ATTTTCTAATGCAACGTAAAAGG - Intergenic
1113157823 13:107345184-107345206 GTCTTCCAATGCAAGAACAAAGG - Intronic
1113211789 13:107991791-107991813 ATTTTCTAATGCAGAATAAATGG - Intergenic
1115014883 14:28598852-28598874 ATATGTCAATGCAAGATATAAGG + Intergenic
1117828279 14:59726208-59726230 GTCTTCAAATGCAAGAAAAATGG - Intronic
1118422287 14:65619918-65619940 AACCTACAATACAAGATAAATGG - Intronic
1119375839 14:74192087-74192109 ATCTTCCAATGCAAGATAAATGG - Intronic
1120300020 14:82694021-82694043 GTCCTCCAATGCCAGATCAAAGG - Intergenic
1120461187 14:84798137-84798159 ATCTTCTAAGGCAATTTAAAGGG - Intergenic
1120477171 14:85002923-85002945 ATCTTGCCAAGCAAGATATAGGG - Intergenic
1120610460 14:86635335-86635357 AGCTTCCAAAGCAAAATAACAGG - Intergenic
1124162024 15:27279868-27279890 ATCTTCCAATCCATGAAAAAAGG + Intronic
1126627472 15:50698803-50698825 ATCCTAAAATGCAAGATAAATGG + Intergenic
1126725839 15:51631112-51631134 ATCATCCACTCCAAGATCAAAGG - Intergenic
1126950645 15:53877004-53877026 AAATTCCAATGTAAAATAAATGG - Intergenic
1127830705 15:62748574-62748596 AGCCTCCAAGGAAAGATAAAAGG - Intronic
1129570592 15:76680091-76680113 ATCTTTCAAACCAAGATCAAAGG + Intronic
1130751013 15:86713159-86713181 TTCTTCCACTGAAAGAGAAAGGG + Intronic
1131220900 15:90583305-90583327 ATTTTTAAATGAAAGATAAAAGG - Intronic
1131855006 15:96584383-96584405 ACCATCCAATTCAAGAGAAAGGG - Intergenic
1133862228 16:9606878-9606900 GTTTTCCAATGCAAGAGAGATGG - Intergenic
1136039962 16:27570942-27570964 ATCTTGAAATCCAAGAGAAAGGG + Intronic
1138882134 16:61029622-61029644 TTCTTCTCATCCAAGATAAAGGG - Intergenic
1139265146 16:65631449-65631471 TTGTTACAATGCAAGATCAATGG - Intergenic
1139813584 16:69646072-69646094 ATTTTCCAATGTAAGAACAATGG - Intronic
1143853340 17:9829644-9829666 GTCTTCTAATGAAACATAAAAGG + Intronic
1147855928 17:43479891-43479913 GTCTTAAAATGCAAGAGAAATGG + Intergenic
1150487551 17:65554403-65554425 ATTTTCTAAGGCAAGATCAAGGG + Intronic
1150678327 17:67263977-67263999 GTGTTCCAACGCAAGATAAAAGG - Intergenic
1151069468 17:71191948-71191970 TTCTTCCAATTCAAGAATAAGGG + Intergenic
1152027056 17:77816973-77816995 ATATTCCCTTGCAAGATGAATGG - Intergenic
1154485479 18:14868498-14868520 ATCCCCCCATGTAAGATAAAGGG + Intergenic
1156974586 18:43203880-43203902 AGCTTCCAAAGCAACATAAAGGG + Intergenic
1157034662 18:43956844-43956866 ATATTCCACTGCAAATTAAATGG + Intergenic
1157594272 18:48854378-48854400 TTCTTCCCATGCAGGTTAAAGGG - Intronic
1164766276 19:30774348-30774370 ATGATCCCATGCAAGATAAATGG + Intergenic
1167406528 19:49312576-49312598 CTCTTCAAATACAAGAGAAAAGG + Intronic
925470143 2:4152144-4152166 AAATTCCAGTGAAAGATAAAGGG - Intergenic
926894915 2:17675482-17675504 ATCTTCAGATGAAAGAAAAATGG - Intronic
928376524 2:30778900-30778922 TTCCTCCAATGCAAGAAAGAGGG + Intronic
930232520 2:48857532-48857554 ATCTTCCAATGCTCCCTAAATGG - Intergenic
931303614 2:61006105-61006127 ATCTTCCAGTCAATGATAAAAGG - Intronic
931609642 2:64085169-64085191 ACATTCCAATGCAAGCTAATAGG + Intergenic
932449241 2:71799055-71799077 ATGTTCCAATCCAAGACACAAGG - Intergenic
932967647 2:76496317-76496339 ATCTTAAAATGTAAGACAAATGG + Intergenic
934371440 2:92749742-92749764 ATCTTCCAATAAAAGCTAGATGG + Intergenic
934471120 2:94537860-94537882 ATCTTCCAATAAAAAATAGAAGG - Intergenic
936293484 2:111247102-111247124 AGCTTCCACTGCAAGAAAATGGG + Intergenic
937799778 2:126069892-126069914 ATATTCCCATGGAATATAAATGG + Intergenic
938625584 2:133105571-133105593 ACCTACCAATGCAAGTAAAATGG - Intronic
943492737 2:188576471-188576493 TTCTTCATATGCATGATAAATGG + Intronic
944016459 2:195045166-195045188 CTTTTCAAATACAAGATAAAAGG - Intergenic
1169041009 20:2495402-2495424 ATTTTCCAAGGCAAGTTACAAGG - Intronic
1169234251 20:3916784-3916806 ATGCTCCATTGCAAAATAAAAGG + Intronic
1170447914 20:16448746-16448768 ATTTTCGAAAGCAAAATAAAGGG + Intronic
1173384913 20:42578288-42578310 ATCTCCCAGTGCAGGGTAAATGG + Intronic
1175614642 20:60386068-60386090 AACTTCCTCAGCAAGATAAAAGG + Intergenic
1179646773 21:42780955-42780977 ATCTTAAAATCCAAGAGAAAGGG + Intergenic
1181686902 22:24535571-24535593 CTCCTCCTATGCAAGAGAAATGG + Intergenic
1184005548 22:41705566-41705588 ATCTTCAAGTGCTAGATACAAGG - Intronic
1202724591 2_KI270715v1_random:137307-137329 ATCTTCCAATAAAAGCTAGATGG + Intergenic
1202724759 2_KI270715v1_random:140026-140048 ATCTTCCAATAAAAGCTAGATGG + Intergenic
1202724927 2_KI270715v1_random:142745-142767 ATCTTCCAATAAAAGCTAGATGG + Intergenic
1202732849 2_KI270716v1_random:101271-101293 ATCTTCCAATAAAAGCTAGATGG + Intergenic
950306720 3:11920922-11920944 ATGTTACAAGGCAAGCTAAAAGG - Intergenic
951249313 3:20375754-20375776 CTCTTCCAATTCAAGCCAAAAGG - Intergenic
951307655 3:21085377-21085399 ATGTACCAAAGCAAGGTAAATGG - Intergenic
951661406 3:25070627-25070649 ATATTCCTATGCTATATAAATGG - Intergenic
953856957 3:46506526-46506548 ATCAGCCAATGAAAGAAAAATGG + Intergenic
956827170 3:73008074-73008096 ATTTCCCAAAGCAAGATTAAGGG - Intronic
957602841 3:82360167-82360189 ATCTTCCATTGCAATAAAAAAGG + Intergenic
959142515 3:102503719-102503741 ATCTTCAAATGCAAAATAAGAGG - Intergenic
959287239 3:104430664-104430686 ATTTTCCTTTCCAAGATAAATGG - Intergenic
959297322 3:104553535-104553557 ACATTCCAATGCAACAGAAATGG - Intergenic
960785984 3:121373238-121373260 ATGCTCCAATGCAGGAGAAACGG + Intronic
961420376 3:126798241-126798263 ATCTCCAAAGGCAAGATAAATGG + Intronic
962523604 3:136218957-136218979 CTCTTCCCATACAAGACAAATGG - Intergenic
963482273 3:145891215-145891237 ATCTCCTAATGCTATATAAAAGG + Intergenic
963879791 3:150516154-150516176 ATCTTCCAATCCAAGAAAATAGG - Intergenic
965786797 3:172343790-172343812 ATATTCTAATGCTAGGTAAATGG - Intronic
966022294 3:175229851-175229873 ATATTCATATGGAAGATAAAAGG + Intronic
966089806 3:176119302-176119324 ACCTTTAAATGCAAGGTAAACGG + Intergenic
967682037 3:192375370-192375392 AATTTCCAATTCAAGATAAAGGG - Intronic
972037054 4:34537792-34537814 ACTTCCCAATACAAGATAAATGG - Intergenic
972040180 4:34584380-34584402 ACCTTCAAATGGAGGATAAATGG - Intergenic
972179598 4:36447207-36447229 ATTGGCCAATGCAAGATACAAGG + Intergenic
972977837 4:44659450-44659472 ATCTCCTAATTCAAAATAAAAGG + Intronic
976191077 4:82487566-82487588 CTCTGCCAATATAAGATAAAAGG - Intronic
977757652 4:100692330-100692352 TTGTTCCAATGAAAGAAAAAAGG - Intronic
978512181 4:109532543-109532565 ATTTTCCAATGCTTCATAAAGGG + Intronic
979195035 4:117910935-117910957 CTCTTCCAATCCAAGAGCAAGGG + Intergenic
980116361 4:128683136-128683158 ATCTTCCACTGCATAAGAAATGG - Intergenic
980223619 4:129951914-129951936 ATCTTCAAATTGAACATAAAGGG + Intergenic
980511703 4:133799240-133799262 CTTTTCCAAAGCAAAATAAATGG + Intergenic
981357430 4:143805784-143805806 ATATTCAAATGCAAGAGAAAAGG + Intergenic
981368839 4:143935028-143935050 ATATTCAAATGCAAGAGAAATGG + Intergenic
981378639 4:144045282-144045304 ATATTCAAATGCAAGAGAAAAGG + Intergenic
983154844 4:164334417-164334439 ATCTTCCTATGCTCTATAAATGG + Intronic
983973970 4:173909878-173909900 CTCTTCAAATGTAAGCTAAAAGG - Intergenic
984568920 4:181366369-181366391 ATCTACCAATGGAAAATATACGG + Intergenic
984724334 4:183005984-183006006 ATCTTTCAATTCATGAAAAAGGG - Intergenic
987734228 5:21818554-21818576 ATCTGCATATTCAAGATAAATGG - Intronic
988075482 5:26348237-26348259 TTCTTCCAAACCAAGAAAAATGG - Intergenic
990253781 5:53943941-53943963 ATTTTTAATTGCAAGATAAATGG + Intronic
991256976 5:64624692-64624714 ATCTTCTATTGAGAGATAAAAGG + Intergenic
992000323 5:72430060-72430082 ACCTTGCAATGCAGGATAAAGGG + Intergenic
993620176 5:90158914-90158936 TTCTTCCAATACAAAAAAAAAGG + Intergenic
994178624 5:96739472-96739494 ATTTTCCAATGTTATATAAATGG - Intronic
994856364 5:105125729-105125751 ATCTTCCAAATGAAGATAATAGG - Intergenic
994995365 5:107055465-107055487 ATGTTCCAATTAAAAATAAAAGG + Intergenic
996983392 5:129528682-129528704 ATTTTCCAATGCCAATTAAATGG + Intronic
998506453 5:142676118-142676140 ATCTTCCCCTGGAAGAAAAAAGG + Intronic
1000699583 5:164431996-164432018 ACCTTTAAATGCAACATAAATGG - Intergenic
1000736923 5:164915020-164915042 ATCTTCCAATGTAAATTATAAGG + Intergenic
1001980395 5:176034095-176034117 CCCTTCCCATGCAAGATAAAGGG - Intronic
1002237066 5:177809970-177809992 CCCTTCCCATGCAAGATAAAGGG + Intergenic
1004558334 6:16721814-16721836 ATCTTTCAATTCTAAATAAATGG + Intronic
1005776516 6:29138110-29138132 ATCTTCCAAGGGAAGGAAAAAGG - Intergenic
1009600827 6:65795926-65795948 ACCTGCCAATGTAAGAAAAATGG + Intergenic
1010351140 6:74875681-74875703 TTCTTCCAAATCAAGACAAAAGG - Intergenic
1010855067 6:80827856-80827878 TTCTTCAAATACAAGATAAGTGG + Intergenic
1011989867 6:93500861-93500883 GTCTTCCAATGCAAGACTATAGG - Intergenic
1012112129 6:95249793-95249815 ATCTTAAAATGCAAAATATAAGG - Intergenic
1012961235 6:105624175-105624197 ATCTGTCTATGAAAGATAAAGGG - Intergenic
1022037906 7:26551233-26551255 AGCTTCCGATGCAAAATAAGAGG - Intergenic
1024647963 7:51384743-51384765 ATCTTCCACTGCAGGTGAAACGG + Intergenic
1027403297 7:77831186-77831208 GTCTTTCAATGCAGGATAAGTGG - Intronic
1027989953 7:85345392-85345414 AATTCCCAATGCAAGATAATTGG - Intergenic
1029323174 7:99783306-99783328 CTCTTCTACTGCAACATAAAGGG + Intronic
1029879321 7:103790441-103790463 ATCTTAAAATGCAAGAGATATGG - Intronic
1031604376 7:123749795-123749817 ATTTTCCAATTCACGATACAGGG - Intergenic
1031764034 7:125752759-125752781 ATCTTCATATGGAAAATAAAAGG - Intergenic
1034138839 7:148797872-148797894 TTCTTCTAGTGTAAGATAAAAGG - Intronic
1034396574 7:150830417-150830439 ATCTAACAATGCAAGGTGAAGGG - Intronic
1036943619 8:13073867-13073889 ATCTTCCTATGCAAGAGACTTGG - Intergenic
1038138794 8:24820561-24820583 ATCTTCAAGGGCAACATAAAAGG - Intergenic
1039313138 8:36341776-36341798 ATCTAGCATTGCAAAATAAAAGG + Intergenic
1041365141 8:57094300-57094322 ATCTTCCACTGGAGGATTAAAGG + Intergenic
1042566308 8:70115856-70115878 AATTTCCAATTCAAGATAAATGG + Intronic
1042957964 8:74271961-74271983 CTCTTCCCATCCAAGACAAAGGG + Intronic
1043494458 8:80784951-80784973 ATCTACTAATGTAAGATAATAGG - Intronic
1043564228 8:81530238-81530260 AACTTCCAAGACAAGATAAGGGG - Intronic
1045945048 8:107786011-107786033 TTCTTCCTAAGCAAAATAAAAGG + Intergenic
1050887785 9:10787097-10787119 ATCTTCTAATCCAAAATAATGGG + Intergenic
1052380612 9:27767005-27767027 ATCCTCCTATGTAAAATAAAAGG + Intergenic
1053712348 9:40830581-40830603 ATCTTCCAATAAAAAATAGAAGG + Intergenic
1054422888 9:64963829-64963851 ATCTTCCAATAAAAAATAGAAGG + Intergenic
1057433034 9:95012636-95012658 CTCCTCCAATACAAGATGAATGG - Intronic
1060045836 9:120339579-120339601 ATCTTACAATGCAAAATTATGGG + Intergenic
1060245611 9:121943499-121943521 ATCTTCCATTGTAAAATAAAAGG - Intronic
1203338830 Un_KI270302v1:745-767 ATCTTCCCATAAAAGCTAAATGG + Intergenic
1203339197 Un_KI270305v1:212-234 ATCTTCCCATAAAAGCTAAATGG + Intergenic
1203339874 Un_KI270320v1:969-991 ATCTTCCCATAAAAGCTAAATGG + Intergenic
1203340001 Un_KI270320v1:2506-2528 ATCTTCCCATAAAAGCTAAATGG + Intergenic
1203340126 Un_KI270320v1:4034-4056 ATCTTCCCATAAAAGCTAAATGG + Intergenic
1203339477 Un_KI270322v1:8345-8367 ATCTTCCCATAAAAGCTAAATGG - Intergenic
1203339605 Un_KI270322v1:9876-9898 ATCTTCCCATAAAAGCTAAACGG - Intergenic
1203339730 Un_KI270322v1:20556-20578 ATCTTCCCATAAAAGCTAAACGG - Intergenic
1186085940 X:5990994-5991016 TTCTTGCAATTCAAAATAAAAGG - Intronic
1187093421 X:16121332-16121354 TTCTTCCAATGTAAGTTAAGGGG - Intergenic
1188864409 X:35297377-35297399 ATCTTGCAATGCATGAACAAGGG + Intergenic
1190211808 X:48454831-48454853 ATCTTCCGATCCATGAAAAATGG - Intergenic
1191669252 X:63733981-63734003 TTCTTCCAAAGGAAGTTAAAAGG + Intronic
1192683548 X:73279981-73280003 ATTTTCCAATGCAAGAAGACTGG - Intergenic
1193878291 X:86890686-86890708 AACTTACAATACAAAATAAACGG + Intergenic
1196894877 X:120325294-120325316 GTCTTCCAATACATGATAATGGG + Intergenic
1197794182 X:130282895-130282917 TGCTTCAAATGCAAGAAAAATGG + Intergenic
1197903857 X:131402394-131402416 TTCTTCCAATAACAGATAAAAGG + Intergenic
1199084424 X:143612279-143612301 CTCTTCCCATGGAAGTTAAAGGG - Intergenic
1199277249 X:145960803-145960825 ATCTTCCAATACATGATTATGGG - Intergenic
1199413683 X:147555417-147555439 ATCCTGCAATGTAAGGTAAAAGG - Intergenic
1199693829 X:150329391-150329413 ATCTCGCAGTGCATGATAAAAGG - Intergenic
1200047293 X:153409729-153409751 CACTTCCACTGCAAGAGAAAGGG - Intergenic
1200491460 Y:3829017-3829039 ATCTTGCAGTTCAAAATAAAAGG - Intergenic
1201038425 Y:9805712-9805734 ATCTTCCCCTGCAAAAAAAAAGG + Intergenic