ID: 1119376267

View in Genome Browser
Species Human (GRCh38)
Location 14:74196143-74196165
Sequence CAGCTCTGTGTACTTGGATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 219}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119376267 Original CRISPR CAGCTCTGTGTACTTGGATT AGG Intronic
904092428 1:27954682-27954704 CAGCCCTGTGTGCTGGGATCTGG + Intronic
904093065 1:27958585-27958607 CAGCACTGTGTGCATGGAGTGGG - Exonic
905352286 1:37356182-37356204 CAGCCCAGTGTGCTTGTATTAGG - Intergenic
905426361 1:37888193-37888215 CAGCTCTGTGTGCTTGAAGATGG + Intronic
906652790 1:47524795-47524817 CAGCTCTGTGTGTTTGGGGTGGG + Intergenic
907302038 1:53493656-53493678 CATCTTTGTGCCCTTGGATTAGG - Intergenic
908397888 1:63742990-63743012 CAGCAATGTGTACTTTCATTTGG - Intergenic
910979553 1:92945761-92945783 AAGCTCAGTTCACTTGGATTTGG + Intronic
911098581 1:94076190-94076212 CACCCCTGTGTACTCTGATTGGG - Intronic
915114188 1:153585224-153585246 CAGCTCTGTGGATTTGCAGTGGG - Intergenic
916315019 1:163439300-163439322 CAGCTCAGTGACCTTGGATAAGG - Intergenic
916474043 1:165151372-165151394 CAGCTCTGATCACTTGGATAAGG + Intergenic
916719481 1:167473564-167473586 CAGCTGTGTGAACTTGGTCTGGG - Intronic
916753815 1:167748690-167748712 AAGCTCTGTGATCTTGTATTAGG - Intronic
917134037 1:171771398-171771420 AAGGTCTGTGAACTTGGATGGGG - Intergenic
917507823 1:175644543-175644565 CAGCTTTGTGGAATTGGATGAGG - Intronic
918074946 1:181162950-181162972 CAGCTGTGTGTACCTGGCTCAGG + Intergenic
920542907 1:206792820-206792842 CAGCTGTGTAGGCTTGGATTGGG - Intergenic
922566920 1:226607054-226607076 GAGCTCTGTGCACTGGGTTTGGG + Exonic
1064680814 10:17809356-17809378 CAGCTCTGGGAACTTGGATTAGG + Exonic
1067690268 10:48497294-48497316 CAGCTCTGTCTCCTTGGCATGGG + Intronic
1070281481 10:75052009-75052031 CACCTGTGTGTGCTTGTATTGGG + Intronic
1070620546 10:78006679-78006701 CAGCTGTGTGTCCTTCCATTCGG - Intronic
1071030095 10:81167918-81167940 CATCTTTGTGATCTTGGATTAGG - Intergenic
1072711686 10:97719667-97719689 CAGCTCTGTGACCATGGATAAGG - Intergenic
1072985962 10:100140374-100140396 CTGCTCTGGGTTCTTGGACTTGG + Intergenic
1075671590 10:124267062-124267084 CAGCTGTGTGTGCTTGGCCTGGG - Intergenic
1077333656 11:1994150-1994172 CAGCTCTGTGCACTGGGAATGGG + Intergenic
1077341818 11:2029612-2029634 CAGCTCTGCCTGCTTGGAGTTGG + Intergenic
1080129755 11:28780549-28780571 CAGCTCTGTCTCTGTGGATTTGG + Intergenic
1082913617 11:58405944-58405966 TAAGTCTGTGTATTTGGATTGGG + Intergenic
1083542645 11:63524180-63524202 AAGCTTTGTGTACATGGGTTGGG + Intergenic
1084970279 11:72767786-72767808 CAGCTGTGTGGCCTTGGCTTGGG + Intronic
1088497476 11:110445698-110445720 CAGCTTTGTGACCTTGGGTTGGG + Intronic
1088649735 11:111946802-111946824 CAGTTCTGTGAACAGGGATTTGG + Intronic
1090328896 11:125914240-125914262 CAGCTCTGTGTGCATGGCTGGGG + Intronic
1090530095 11:127581977-127581999 CAGATATGTGTACTTCCATTGGG - Intergenic
1091338724 11:134794123-134794145 CAGCTCTGTTTACCTGGAGGAGG + Intergenic
1202816637 11_KI270721v1_random:49332-49354 CAGCTCTGTGCACTGGGAATGGG + Intergenic
1202824804 11_KI270721v1_random:84801-84823 CAGCTCTGCCTGCTTGGAGTTGG + Intergenic
1091871927 12:3899258-3899280 CACGTCTGTGTACTTGGCCTTGG + Intergenic
1096036019 12:48471368-48471390 CAGCACTGTTTACTAAGATTTGG - Intergenic
1097593149 12:61596120-61596142 CAGCTCAGTCTCCTTGGATCTGG - Intergenic
1102437631 12:112937845-112937867 CAGCTCTGTGGGCTTGGGCTGGG + Intergenic
1103421937 12:120792879-120792901 AATCTCTGTGACCTTGGATTTGG + Intronic
1106134994 13:26967365-26967387 TGGCTTTGTGGACTTGGATTTGG - Intergenic
1106353662 13:28958271-28958293 CAGCTGTCTGTACTTGGCGTGGG + Intronic
1107627432 13:42304114-42304136 TAGCTCTATGAACTTGGATAAGG - Intronic
1109519987 13:63497374-63497396 TAGCTCTTTATAATTGGATTAGG + Intergenic
1112067938 13:95814355-95814377 CATATCAGTGTACTTGGATGTGG + Intronic
1113255595 13:108501204-108501226 CATCTCTGTGTGTCTGGATTGGG + Intergenic
1113261455 13:108568767-108568789 AATCTCTGTGGCCTTGGATTAGG - Intergenic
1114301325 14:21381421-21381443 CAACCCTGTGTACTTGTATTTGG + Intronic
1117342344 14:54803261-54803283 AAGCTATGTGTACTTTAATTAGG + Intergenic
1119376267 14:74196143-74196165 CAGCTCTGTGTACTTGGATTAGG + Intronic
1119857275 14:77909998-77910020 CAGCTCTGTGCACTTTGATGCGG - Intronic
1120169787 14:81236621-81236643 CAGCACTGTGTATTTAGCTTGGG + Intergenic
1120948962 14:90023335-90023357 CAGTTCTGTGTGCTTGGAATGGG + Intronic
1121496141 14:94392360-94392382 CAGCTAGGTGGACTTGGATCCGG + Intergenic
1123999194 15:25740697-25740719 CACCTCTGTCTACCTGGCTTTGG + Intronic
1125449030 15:39788713-39788735 CTGATCTGTGTACTTGGTTGAGG + Intergenic
1126435842 15:48636689-48636711 CAGCCCTGTTTACTTGGGTGTGG - Intronic
1126921982 15:53536962-53536984 TACCTCTGTTTAATTGGATTGGG - Intronic
1127426585 15:58864738-58864760 CAGCTCTGTGTCCTTGGACAAGG - Intergenic
1128260534 15:66229781-66229803 CAGCTCTGTGTCCTTGTCCTGGG - Intronic
1128502911 15:68241256-68241278 CAGCACTGTGTATTTGTTTTTGG - Intronic
1132784325 16:1646734-1646756 CATCTCTGTGACCTTGGGTTAGG - Intronic
1132784787 16:1650218-1650240 CAGCTTTGTTTACTGGGATGTGG + Intronic
1133497617 16:6334599-6334621 CACATCTGTGTATCTGGATTGGG + Intronic
1135388857 16:22071196-22071218 CAGCTCTAGGTACTATGATTTGG - Intronic
1137777954 16:51072102-51072124 CAGCTATGTGGACTTAGATCAGG - Intergenic
1138483006 16:57316614-57316636 CAGCTCTATCTCCTTGGCTTGGG + Intergenic
1139530849 16:67542052-67542074 CAGCTCTGGGCCCTTGGATGAGG + Exonic
1140269593 16:73453317-73453339 CTGCTTTGTGTAATTGGATGTGG + Intergenic
1140849203 16:78918895-78918917 CTCCTCTGTGTTCTTGGAATAGG - Intronic
1141831802 16:86513233-86513255 CAGCGCTGTGTCTTTGCATTGGG - Exonic
1144872381 17:18379182-18379204 CAGCTCTCTGTGGATGGATTGGG + Intronic
1144873589 17:18384834-18384856 CAGCTCTCTGTGGATGGATTGGG + Intronic
1146831486 17:36073135-36073157 CAGGTCTGTGAACTTGGACCAGG + Intergenic
1146845438 17:36179099-36179121 CAGGGCTGTGTGCTTGGCTTGGG + Intronic
1146873653 17:36390942-36390964 CAGGGCTGTGTGCTTGGCTTGGG + Intronic
1146881012 17:36442030-36442052 CAGGGCTGTGTGCTTGGCTTGGG + Intergenic
1147065735 17:37921931-37921953 CAGGGCTGTGTGCTTGGCTTGGG - Intergenic
1147122265 17:38342836-38342858 CAGCTGTGTGTACTTACAGTCGG - Intronic
1147390791 17:40107971-40107993 CTGTTCTGTGTTCTTGGCTTGGG + Intergenic
1147562774 17:41519279-41519301 CAGCTCCGTGTTCTTAGTTTGGG + Exonic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1152486920 17:80600589-80600611 CAGCTCTTTAGACCTGGATTGGG + Intronic
1152607366 17:81299385-81299407 CAACTCTGTGTCCTTCGATGCGG + Intergenic
1156421513 18:36958895-36958917 CATCTTTGTGACCTTGGATTAGG - Intronic
1156532156 18:37828042-37828064 CAGCTTTGTTTTCTTGGCTTAGG + Intergenic
1157099247 18:44714546-44714568 CAGCTCTGTGTATTTTGCATTGG + Intronic
1159264209 18:66058204-66058226 TAGTTCTGTGTACTTGGATTGGG + Intergenic
1160223139 18:76991824-76991846 CAGCTCTATGCACATTGATTGGG + Intronic
1160349546 18:78164579-78164601 GAGTTCTGTGTATTTGGATCAGG + Intergenic
1161055103 19:2186965-2186987 GAGCTCTGTGTCCGTGGAGTTGG + Intronic
1162457452 19:10794309-10794331 CAGCCCTGGGTGCTAGGATTTGG + Intronic
1163647948 19:18500947-18500969 CAACTCTGTGGAGTTGAATTTGG - Intronic
1165073240 19:33267665-33267687 CAGCTCTGGGTTCCTGGAGTGGG - Intergenic
1166646136 19:44533093-44533115 CAGCTCTGTTGTCTTGGATGGGG - Intergenic
1168411388 19:56142319-56142341 CAGCTCTGTGTCCTTGGACGAGG - Intronic
1168567593 19:57437937-57437959 CAGCTCTGTGTCTTTGGACAAGG - Intronic
925462011 2:4071636-4071658 CAGCTCTGAGCACTTGCATCAGG - Intergenic
925996637 2:9298792-9298814 CAGCTCTGTGTGCATGGAAAGGG - Intronic
926429414 2:12770785-12770807 CGACTCTGTGTACTTAGCTTTGG + Intergenic
926615864 2:14995951-14995973 GAGCTGTGTGTACTTGTGTTGGG - Intergenic
926954281 2:18277121-18277143 GAGCACTGAGTACTTGGAATAGG - Intronic
928407410 2:31025109-31025131 CTGATCTGAGTACTTGTATTGGG + Intronic
928947794 2:36787581-36787603 CAGCTCTGTGGCCTTGGGCTAGG + Intronic
929867733 2:45732640-45732662 AAGCTATGTGTAGCTGGATTTGG - Intronic
932681740 2:73831814-73831836 CAGTTCTGTGTGCATGGAATAGG + Intronic
933653753 2:84870629-84870651 CAGCATTGTGTACTTTGAGTTGG - Exonic
934564482 2:95330708-95330730 CAGCCCAGTGAACTGGGATTGGG - Intronic
934886743 2:98031797-98031819 GAGGCCTGTGGACTTGGATTAGG - Intergenic
935860072 2:107319952-107319974 CAGGCCTGTGTACTTGGTATTGG + Intergenic
937242425 2:120470890-120470912 CAGCCATGTGAACTTGGATCAGG + Intergenic
938591799 2:132746453-132746475 TATCTCTGTGGCCTTGGATTAGG + Intronic
939547822 2:143575329-143575351 CAGCTCTGTCTAGTTGAAATGGG - Intronic
940701218 2:157045197-157045219 GTGCTCCGTGTACTTGGTTTGGG - Intergenic
945048677 2:205803174-205803196 CAGCTCTCTGCACTTTGCTTTGG - Intergenic
945897352 2:215498599-215498621 AATCTCTGTGTACCTGGACTTGG - Intergenic
946000771 2:216480448-216480470 CAGCTTTTTCTACTTGGAATAGG + Intronic
948072807 2:235141030-235141052 TTGCTCTGTGAAGTTGGATTGGG - Intergenic
948444443 2:238021122-238021144 CAGCTCTTTGTTCTTGGCTCTGG + Intronic
1168740876 20:190503-190525 CAGCTCTGTTTAGTTGGGTCAGG - Intergenic
1169061953 20:2666913-2666935 CAGCACTGTGAACCTGGATGGGG + Intergenic
1170207772 20:13817862-13817884 CAGGACTGTGAACTTGGATTAGG - Exonic
1170506931 20:17036280-17036302 AAGGTCTTTATACTTGGATTTGG + Intergenic
1173283703 20:41651775-41651797 AAGCTCTTTGCACTTGGCTTGGG - Intergenic
1174359264 20:50017651-50017673 TGGCTCTGTGACCTTGGATTTGG - Intergenic
1175135549 20:56821030-56821052 TGGCTCTGAGTACTTGGACTAGG + Intergenic
1175309566 20:58002339-58002361 CAGCTGGGTGTACTGGAATTTGG - Intergenic
1176136252 20:63523298-63523320 CAGCTGTGTGTACATGGAGGAGG - Intergenic
1177882410 21:26709810-26709832 GAGCTCTGTGAATTTGGACTCGG + Intergenic
1177935753 21:27343315-27343337 TAGCTCTGTGATTTTGGATTAGG - Intergenic
1181589165 22:23872502-23872524 GAGCTCTTTGAACTTGGCTTGGG + Intronic
1185225110 22:49647746-49647768 CAGCTGTGTGGACTGGGAGTTGG - Intronic
949098133 3:111113-111135 CAGCTATGTGAACTTGAATAAGG + Intergenic
949367922 3:3302956-3302978 CACCTCTCTGTATCTGGATTCGG - Intergenic
950872237 3:16239539-16239561 CAGCTCCGTGTACTCAGTTTGGG + Intergenic
950895881 3:16450380-16450402 CACCTCTGTGCACCTGGATGTGG - Intronic
952474080 3:33687558-33687580 CAGCTCTTTGTGCTGGGTTTTGG - Intronic
953271676 3:41451550-41451572 CAGCTGTGTGATCTTGGATGGGG - Intronic
953454063 3:43028516-43028538 GAGCTCTGTGTTCTTTCATTAGG - Intronic
954102302 3:48383644-48383666 CATCTCTGTGATCTTGGGTTAGG - Intronic
956837583 3:73108012-73108034 CAGCTCTCTGTACTGTGCTTTGG + Intergenic
957956365 3:87193677-87193699 GAGCTCACTGTACTTAGATTAGG - Intergenic
959458146 3:106589614-106589636 CAGTTCTGTGTGCTTAGGTTTGG - Intergenic
961037502 3:123652819-123652841 TGGCTCTGTGCACTTGGGTTTGG + Intronic
961658546 3:128456458-128456480 CACCTCTGTGTGCTGGGACTTGG - Intergenic
963481978 3:145887444-145887466 CAGCTCTGTGACCTTGTGTTGGG + Intergenic
965887855 3:173470734-173470756 CAGCTCAGTATATTTTGATTAGG + Intronic
966450702 3:180057785-180057807 CAGCTGTGTGTGCTTGGATGTGG - Intergenic
966646970 3:182257121-182257143 CAGTTCTGATTACTTGGATTAGG + Intergenic
966785408 3:183618806-183618828 CAGCCCTGTGGCCTTGGATCTGG - Intergenic
967306171 3:188061629-188061651 CTGCTGTGTGAACTTGGATAAGG - Intergenic
967558165 3:190884149-190884171 CTACTCTGTAGACTTGGATTTGG - Intronic
967990039 3:195123855-195123877 CTGCTCTGTGTGCTGGAATTAGG - Intronic
968580326 4:1387525-1387547 AATCTCTGTGATCTTGGATTAGG - Exonic
968963716 4:3758879-3758901 CAGCCCTGGGTACCTGGCTTGGG - Intergenic
969509474 4:7609604-7609626 CTGCTCTGTGTCCTTGGCCTAGG + Intronic
972064950 4:34930256-34930278 AAGCTCTGTGGAATTGGTTTGGG + Intergenic
974360958 4:60878472-60878494 AAGCTTTGTGATCTTGGATTAGG + Intergenic
976118774 4:81757478-81757500 CAGAGCTGTGTATTAGGATTTGG + Intronic
979267934 4:118725223-118725245 CAGCTCTAGGTACTGGGAGTTGG + Intronic
980629404 4:135413207-135413229 CAGCTCTGATTACTTCTATTTGG - Intergenic
981321564 4:143397714-143397736 CAGCTCTCTATACTTGGATATGG - Intronic
982073849 4:151719380-151719402 CAGCTCTGAGAACTTGCAGTGGG + Intronic
983525088 4:168752581-168752603 CAGTTCTGTGTTCTGAGATTAGG + Intronic
983533996 4:168838289-168838311 CAGCTCTGTGCTCTTGGCTGAGG - Intronic
984890945 4:184492299-184492321 AAGCTCTGTGTACATGTGTTGGG - Intergenic
987044743 5:14097197-14097219 CATCTTTGTGACCTTGGATTAGG + Intergenic
988416941 5:30957258-30957280 CAGCTTTATTTACTTGAATTTGG - Intergenic
989076279 5:37566316-37566338 CATCACTGTGTACTTTAATTAGG + Intronic
994886600 5:105571087-105571109 CATTTTTGTGAACTTGGATTAGG + Intergenic
994969255 5:106715308-106715330 CAGCTTTGTTGACTTGGCTTAGG + Intergenic
996100819 5:119443735-119443757 CAGCTTTGTTCTCTTGGATTAGG - Intergenic
996799386 5:127386178-127386200 CAGTTCTGTGTACCTGTACTAGG - Intronic
997934280 5:138097041-138097063 CTGCTCTGTCCACTGGGATTGGG + Intergenic
999990638 5:157046901-157046923 CAGCTCTTAATACTTGCATTGGG + Intronic
1000077665 5:157808127-157808149 CAGCTCTGTATATTTGAAGTGGG - Intronic
1001622937 5:173104168-173104190 CATGTCTGTGTACTGTGATTTGG + Intronic
1004249531 6:14012189-14012211 CAGCTCTTTGGACTTGGACCAGG - Intergenic
1004268475 6:14171893-14171915 AATCTCTGTGAACTTGGGTTAGG + Intergenic
1004580840 6:16949983-16950005 CAGCTCCTTTTACTTGGACTTGG + Intergenic
1006297815 6:33177815-33177837 CAGCTGTGTTTGCTTGGGTTTGG - Intronic
1007964459 6:45990878-45990900 CAGCTCTGTGATCTTGGAAAAGG + Intronic
1010667878 6:78651416-78651438 CAGCTCTGTTTTTTTGGCTTAGG - Intergenic
1010821234 6:80418592-80418614 TAACTCTGTGTTCTTGTATTGGG + Intergenic
1011625860 6:89282889-89282911 CAGCTCCGTGTTCTTGACTTCGG + Intronic
1012280601 6:97323436-97323458 CATCTCTGGGTATTTGGATTGGG + Intergenic
1012679021 6:102154580-102154602 CAGGTCTGTGTACTTCCCTTTGG - Intergenic
1016376722 6:143428944-143428966 CAGCTTTGTGATCTTGGGTTAGG + Intronic
1017859454 6:158381851-158381873 CATTTGTGTTTACTTGGATTTGG + Intronic
1017866932 6:158452066-158452088 CAGCTTTGGGAACCTGGATTTGG + Intronic
1019764809 7:2842847-2842869 CAACTTTGTGTAGTTGGATTAGG - Intronic
1019803720 7:3107098-3107120 CTTCTCTGTGCACTTGGACTGGG + Intergenic
1020450661 7:8317167-8317189 CAGACCTGTCTAATTGGATTTGG - Intergenic
1020950886 7:14675523-14675545 CAACTCTGTATATTGGGATTTGG + Intronic
1022470342 7:30678103-30678125 CTGCCCTGTGTTCTTGGCTTGGG + Intronic
1022810486 7:33863258-33863280 CAACTCTGGGTCCTTGGACTGGG + Intergenic
1023647526 7:42334042-42334064 AATCTCTGTGACCTTGGATTAGG + Intergenic
1024720423 7:52131103-52131125 AATCTTTGTGTACTTGGATTTGG - Intergenic
1024842643 7:53604358-53604380 CAACCCTGGATACTTGGATTGGG - Intergenic
1027954757 7:84863974-84863996 CAGCACTGTGTACTTTGAGAAGG + Intergenic
1028365277 7:90021881-90021903 AAGCTCTGTGTACTTGGAAGAGG - Intergenic
1028435862 7:90803044-90803066 AAGCTCTGGGTGCTTGGATAGGG + Intronic
1030184545 7:106748418-106748440 AAGCTCTCTGTCATTGGATTTGG + Intergenic
1030577097 7:111301993-111302015 CAGCTCTGTGAGCCTGGATAAGG - Intronic
1033152174 7:138924995-138925017 CAGCGCTGGCTACTTGGAGTGGG - Intronic
1033578043 7:142704825-142704847 CAGCTGTGTGTAACAGGATTAGG + Intergenic
1035729131 8:1842333-1842355 CAGCTCTCTGCACTAGGATAAGG + Intronic
1036901961 8:12676584-12676606 CAGCTCTGTGTTGGCGGATTGGG + Intergenic
1037295282 8:17393305-17393327 AATCTCTGTGACCTTGGATTAGG + Intronic
1039136835 8:34334457-34334479 AATCTCAGTGTTCTTGGATTTGG - Intergenic
1042773213 8:72401164-72401186 CAACTCTGTGCTCTTGGATAGGG + Intergenic
1044054741 8:87554705-87554727 CAGCTCTGTTCATTTGGCTTAGG + Intronic
1044407527 8:91846138-91846160 CAACACTGTGTAATTGTATTTGG - Intergenic
1046071312 8:109258079-109258101 CATCTTTGTGGCCTTGGATTAGG - Intronic
1049120200 8:140729837-140729859 CAGCTCTGTGTCCTTCTATCAGG + Intronic
1049484710 8:142849150-142849172 CAGTGCTGTGTATTTGGTTTTGG + Intronic
1056419952 9:86414498-86414520 CAGTTCTTTGTACAGGGATTTGG + Intergenic
1060957713 9:127655495-127655517 AAGCTAGGTGTCCTTGGATTTGG - Intronic
1061217715 9:129231436-129231458 CAGCTCTGAGTAGTTGGGTGGGG + Intergenic
1062023966 9:134332021-134332043 CAGCTCTGTGCCCTGGGACTGGG + Intronic
1186328756 X:8509741-8509763 CAGCTCTGTATACTGGAGTTTGG + Intergenic
1187337822 X:18396095-18396117 CAGCTCTGTGAAAATGGATCTGG - Intergenic
1188230888 X:27661139-27661161 CAGCTCTCTGTAATAGGCTTAGG + Intronic
1188631364 X:32366019-32366041 AAGGTCTGTGAACTTGGATTGGG - Intronic
1189103099 X:38211327-38211349 CGCCTCTGTGTATTTTGATTTGG - Intronic
1189858703 X:45250275-45250297 CAGTTGTCTGTACTTGTATTTGG + Intergenic
1191062770 X:56317411-56317433 GAGATCTGTGAACTTGGATGGGG + Intergenic
1193054276 X:77133423-77133445 CAGCTTTGTTTTCTTGGCTTAGG + Intergenic
1193152398 X:78139306-78139328 CAGCTTTGTGTCCTGGGCTTCGG - Intronic
1193705873 X:84820091-84820113 CAGCTGTGGGTAATAGGATTAGG - Intergenic
1198124814 X:133632449-133632471 TATCTCTGTGTAGTAGGATTAGG + Intronic
1199244989 X:145593519-145593541 CAGTTCTGTATATTTGGTTTTGG - Intergenic
1201433534 Y:13931025-13931047 CAGCTCTGTATACTGGAGTTTGG - Intergenic