ID: 1119378242

View in Genome Browser
Species Human (GRCh38)
Location 14:74212176-74212198
Sequence TCCCTCGAAGGAGAGCCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119378242_1119378252 27 Left 1119378242 14:74212176-74212198 CCCTTGGGCTCTCCTTCGAGGGA No data
Right 1119378252 14:74212226-74212248 AGAAATCAGTCCCCAGACTGGGG No data
1119378242_1119378253 28 Left 1119378242 14:74212176-74212198 CCCTTGGGCTCTCCTTCGAGGGA No data
Right 1119378253 14:74212227-74212249 GAAATCAGTCCCCAGACTGGGGG No data
1119378242_1119378250 25 Left 1119378242 14:74212176-74212198 CCCTTGGGCTCTCCTTCGAGGGA No data
Right 1119378250 14:74212224-74212246 TGAGAAATCAGTCCCCAGACTGG No data
1119378242_1119378251 26 Left 1119378242 14:74212176-74212198 CCCTTGGGCTCTCCTTCGAGGGA No data
Right 1119378251 14:74212225-74212247 GAGAAATCAGTCCCCAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119378242 Original CRISPR TCCCTCGAAGGAGAGCCCAA GGG (reversed) Intergenic
No off target data available for this crispr