ID: 1119378245

View in Genome Browser
Species Human (GRCh38)
Location 14:74212202-74212224
Sequence AGTAAAGGGTGGGTAGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119378245_1119378251 0 Left 1119378245 14:74212202-74212224 CCTTTGTCTACCCACCCTTTACT No data
Right 1119378251 14:74212225-74212247 GAGAAATCAGTCCCCAGACTGGG No data
1119378245_1119378257 18 Left 1119378245 14:74212202-74212224 CCTTTGTCTACCCACCCTTTACT No data
Right 1119378257 14:74212243-74212265 CTGGGGGCTCCTCAAGAGCGAGG No data
1119378245_1119378250 -1 Left 1119378245 14:74212202-74212224 CCTTTGTCTACCCACCCTTTACT No data
Right 1119378250 14:74212224-74212246 TGAGAAATCAGTCCCCAGACTGG No data
1119378245_1119378252 1 Left 1119378245 14:74212202-74212224 CCTTTGTCTACCCACCCTTTACT No data
Right 1119378252 14:74212226-74212248 AGAAATCAGTCCCCAGACTGGGG No data
1119378245_1119378253 2 Left 1119378245 14:74212202-74212224 CCTTTGTCTACCCACCCTTTACT No data
Right 1119378253 14:74212227-74212249 GAAATCAGTCCCCAGACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119378245 Original CRISPR AGTAAAGGGTGGGTAGACAA AGG (reversed) Intergenic
No off target data available for this crispr