ID: 1119378247

View in Genome Browser
Species Human (GRCh38)
Location 14:74212213-74212235
Sequence ACTGATTTCTCAGTAAAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119378247_1119378257 7 Left 1119378247 14:74212213-74212235 CCACCCTTTACTGAGAAATCAGT No data
Right 1119378257 14:74212243-74212265 CTGGGGGCTCCTCAAGAGCGAGG No data
1119378247_1119378253 -9 Left 1119378247 14:74212213-74212235 CCACCCTTTACTGAGAAATCAGT No data
Right 1119378253 14:74212227-74212249 GAAATCAGTCCCCAGACTGGGGG No data
1119378247_1119378252 -10 Left 1119378247 14:74212213-74212235 CCACCCTTTACTGAGAAATCAGT No data
Right 1119378252 14:74212226-74212248 AGAAATCAGTCCCCAGACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119378247 Original CRISPR ACTGATTTCTCAGTAAAGGG TGG (reversed) Intergenic
No off target data available for this crispr