ID: 1119378253

View in Genome Browser
Species Human (GRCh38)
Location 14:74212227-74212249
Sequence GAAATCAGTCCCCAGACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119378245_1119378253 2 Left 1119378245 14:74212202-74212224 CCTTTGTCTACCCACCCTTTACT No data
Right 1119378253 14:74212227-74212249 GAAATCAGTCCCCAGACTGGGGG No data
1119378247_1119378253 -9 Left 1119378247 14:74212213-74212235 CCACCCTTTACTGAGAAATCAGT No data
Right 1119378253 14:74212227-74212249 GAAATCAGTCCCCAGACTGGGGG No data
1119378243_1119378253 27 Left 1119378243 14:74212177-74212199 CCTTGGGCTCTCCTTCGAGGGAG No data
Right 1119378253 14:74212227-74212249 GAAATCAGTCCCCAGACTGGGGG No data
1119378242_1119378253 28 Left 1119378242 14:74212176-74212198 CCCTTGGGCTCTCCTTCGAGGGA No data
Right 1119378253 14:74212227-74212249 GAAATCAGTCCCCAGACTGGGGG No data
1119378244_1119378253 16 Left 1119378244 14:74212188-74212210 CCTTCGAGGGAGCACCTTTGTCT No data
Right 1119378253 14:74212227-74212249 GAAATCAGTCCCCAGACTGGGGG No data
1119378246_1119378253 -8 Left 1119378246 14:74212212-74212234 CCCACCCTTTACTGAGAAATCAG No data
Right 1119378253 14:74212227-74212249 GAAATCAGTCCCCAGACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119378253 Original CRISPR GAAATCAGTCCCCAGACTGG GGG Intergenic
No off target data available for this crispr