ID: 1119379471

View in Genome Browser
Species Human (GRCh38)
Location 14:74219449-74219471
Sequence GGCTCCTGACCGGTGGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119379471_1119379475 -9 Left 1119379471 14:74219449-74219471 CCAGGAACCACCGGTCAGGAGCC No data
Right 1119379475 14:74219463-74219485 TCAGGAGCCCTGAGGTCCCATGG No data
1119379471_1119379487 26 Left 1119379471 14:74219449-74219471 CCAGGAACCACCGGTCAGGAGCC No data
Right 1119379487 14:74219498-74219520 CTCCCAGCATCCCCAGGCGCGGG No data
1119379471_1119379484 20 Left 1119379471 14:74219449-74219471 CCAGGAACCACCGGTCAGGAGCC No data
Right 1119379484 14:74219492-74219514 CCAATCCTCCCAGCATCCCCAGG No data
1119379471_1119379486 25 Left 1119379471 14:74219449-74219471 CCAGGAACCACCGGTCAGGAGCC No data
Right 1119379486 14:74219497-74219519 CCTCCCAGCATCCCCAGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119379471 Original CRISPR GGCTCCTGACCGGTGGTTCC TGG (reversed) Intergenic