ID: 1119379473

View in Genome Browser
Species Human (GRCh38)
Location 14:74219456-74219478
Sequence ACCTCAGGGCTCCTGACCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119379473_1119379487 19 Left 1119379473 14:74219456-74219478 CCACCGGTCAGGAGCCCTGAGGT No data
Right 1119379487 14:74219498-74219520 CTCCCAGCATCCCCAGGCGCGGG No data
1119379473_1119379486 18 Left 1119379473 14:74219456-74219478 CCACCGGTCAGGAGCCCTGAGGT No data
Right 1119379486 14:74219497-74219519 CCTCCCAGCATCCCCAGGCGCGG No data
1119379473_1119379484 13 Left 1119379473 14:74219456-74219478 CCACCGGTCAGGAGCCCTGAGGT No data
Right 1119379484 14:74219492-74219514 CCAATCCTCCCAGCATCCCCAGG No data
1119379473_1119379493 30 Left 1119379473 14:74219456-74219478 CCACCGGTCAGGAGCCCTGAGGT No data
Right 1119379493 14:74219509-74219531 CCCAGGCGCGGGTTTCCAGGAGG No data
1119379473_1119379490 27 Left 1119379473 14:74219456-74219478 CCACCGGTCAGGAGCCCTGAGGT No data
Right 1119379490 14:74219506-74219528 ATCCCCAGGCGCGGGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119379473 Original CRISPR ACCTCAGGGCTCCTGACCGG TGG (reversed) Intergenic