ID: 1119379474

View in Genome Browser
Species Human (GRCh38)
Location 14:74219459-74219481
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119379474_1119379487 16 Left 1119379474 14:74219459-74219481 CCGGTCAGGAGCCCTGAGGTCCC No data
Right 1119379487 14:74219498-74219520 CTCCCAGCATCCCCAGGCGCGGG No data
1119379474_1119379490 24 Left 1119379474 14:74219459-74219481 CCGGTCAGGAGCCCTGAGGTCCC No data
Right 1119379490 14:74219506-74219528 ATCCCCAGGCGCGGGTTTCCAGG No data
1119379474_1119379493 27 Left 1119379474 14:74219459-74219481 CCGGTCAGGAGCCCTGAGGTCCC No data
Right 1119379493 14:74219509-74219531 CCCAGGCGCGGGTTTCCAGGAGG No data
1119379474_1119379484 10 Left 1119379474 14:74219459-74219481 CCGGTCAGGAGCCCTGAGGTCCC No data
Right 1119379484 14:74219492-74219514 CCAATCCTCCCAGCATCCCCAGG No data
1119379474_1119379486 15 Left 1119379474 14:74219459-74219481 CCGGTCAGGAGCCCTGAGGTCCC No data
Right 1119379486 14:74219497-74219519 CCTCCCAGCATCCCCAGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119379474 Original CRISPR GGGACCTCAGGGCTCCTGAC CGG (reversed) Intergenic